Transcript: Human NM_017696.2

Homo sapiens minichromosome maintenance 9 homologous recombination repair factor (MCM9), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
MCM9 (254394)
Length:
4822
CDS:
16..3447

Additional Resources:

NCBI RefSeq record:
NM_017696.2
NBCI Gene record:
MCM9 (254394)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_017696.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000154982 GCGGGATTACATGTGTAACAA pLKO.1 441 CDS 100% 5.625 7.875 N MCM9 n/a
2 TRCN0000156814 GCCCTCAAGTGTTTGGAATGT pLKO.1 947 CDS 100% 4.950 6.930 N MCM9 n/a
3 TRCN0000430447 CCAGTGAAGTGCTTACAATTT pLKO_005 200 CDS 100% 13.200 10.560 N MCM9 n/a
4 TRCN0000150721 CGGGATTACATGTGTAACAAA pLKO.1 442 CDS 100% 5.625 4.500 N MCM9 n/a
5 TRCN0000423740 AGCAAATTACATCCAAGTAAA pLKO_005 807 CDS 100% 13.200 9.240 N MCM9 n/a
6 TRCN0000418860 CATTACCCAGTTGTGGTTAAT pLKO_005 124 CDS 100% 13.200 9.240 N MCM9 n/a
7 TRCN0000429370 TATGTTTCGGAATACCATAAG pLKO_005 61 CDS 100% 10.800 7.560 N MCM9 n/a
8 TRCN0000156219 CCACAGGAATTGGATCTACTA pLKO.1 1139 CDS 100% 4.950 3.465 N MCM9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_017696.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09900 pDONR223 100% 34% 33.6% None (many diffs) n/a
2 ccsbBroad304_09900 pLX_304 0% 34% 33.6% V5 (many diffs) n/a
3 TRCN0000472476 ATTAATAATCGAGACTTTACAAAT pLX_317 46.1% 34% 33.6% V5 (many diffs) n/a
Download CSV