Transcript: Human NM_153255.4

Homo sapiens minichromosome maintenance 9 homologous recombination repair factor (MCM9), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-04-09
Taxon:
Homo sapiens (human)
Gene:
MCM9 (254394)
Length:
2507
CDS:
288..1463

Additional Resources:

NCBI RefSeq record:
NM_153255.4
NBCI Gene record:
MCM9 (254394)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_153255.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000154982 GCGGGATTACATGTGTAACAA pLKO.1 713 CDS 100% 5.625 7.875 N MCM9 n/a
2 TRCN0000156814 GCCCTCAAGTGTTTGGAATGT pLKO.1 1219 CDS 100% 4.950 6.930 N MCM9 n/a
3 TRCN0000430447 CCAGTGAAGTGCTTACAATTT pLKO_005 472 CDS 100% 13.200 10.560 N MCM9 n/a
4 TRCN0000150721 CGGGATTACATGTGTAACAAA pLKO.1 714 CDS 100% 5.625 4.500 N MCM9 n/a
5 TRCN0000423740 AGCAAATTACATCCAAGTAAA pLKO_005 1079 CDS 100% 13.200 9.240 N MCM9 n/a
6 TRCN0000418860 CATTACCCAGTTGTGGTTAAT pLKO_005 396 CDS 100% 13.200 9.240 N MCM9 n/a
7 TRCN0000429370 TATGTTTCGGAATACCATAAG pLKO_005 333 CDS 100% 10.800 7.560 N MCM9 n/a
8 TRCN0000156219 CCACAGGAATTGGATCTACTA pLKO.1 1411 CDS 100% 4.950 3.465 N MCM9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153255.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09900 pDONR223 100% 99.9% 100% None 573G>A n/a
2 ccsbBroad304_09900 pLX_304 0% 99.9% 100% V5 573G>A n/a
3 TRCN0000472476 ATTAATAATCGAGACTTTACAAAT pLX_317 46.1% 99.9% 100% V5 573G>A n/a
Download CSV