Construct: ORF TRCN0000472480
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002773.1_s317c1
- Derived from:
- ccsbBroadEn_00087
- DNA Barcode:
- CAAGCTTGTATCCCTCCGATAAAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- FAS (355)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472480
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 355 | FAS | Fas cell surface death rece... | NM_000043.6 | 99.9% | 100% | 642T>C |
| 2 | human | 355 | FAS | Fas cell surface death rece... | XM_011539767.3 | 94.9% | 91.8% | (many diffs) |
| 3 | human | 355 | FAS | Fas cell surface death rece... | NM_152871.4 | 93.6% | 93.7% | 504_505ins63;579T>C |
| 4 | human | 355 | FAS | Fas cell surface death rece... | XM_006717819.3 | 91.6% | 90.3% | (many diffs) |
| 5 | human | 355 | FAS | Fas cell surface death rece... | XM_011539766.2 | 91.6% | 90.3% | (many diffs) |
| 6 | human | 355 | FAS | Fas cell surface death rece... | XM_011539764.2 | 85.2% | 84.1% | (many diffs) |
| 7 | human | 355 | FAS | Fas cell surface death rece... | XM_011539765.2 | 79.8% | 78.7% | (many diffs) |
| 8 | human | 355 | FAS | Fas cell surface death rece... | NM_152872.4 | 65.5% | 64.7% | 642T>C;651_652ins25;660_661ins320 |
| 9 | human | 355 | FAS | Fas cell surface death rece... | NM_001320619.2 | 58.8% | 56.3% | 568_569ins83;591_592ins331 |
| 10 | human | 355 | FAS | Fas cell surface death rece... | XR_945732.3 | 35.2% | (many diffs) | |
| 11 | human | 355 | FAS | Fas cell surface death rece... | NR_135314.2 | 26.3% | (many diffs) | |
| 12 | human | 355 | FAS | Fas cell surface death rece... | NR_028036.4 | 24.2% | (many diffs) | |
| 13 | human | 355 | FAS | Fas cell surface death rece... | NR_028033.4 | 22.5% | (many diffs) | |
| 14 | human | 355 | FAS | Fas cell surface death rece... | NR_135313.2 | 21.9% | (many diffs) | |
| 15 | human | 355 | FAS | Fas cell surface death rece... | XR_945733.2 | 21.7% | (many diffs) | |
| 16 | human | 355 | FAS | Fas cell surface death rece... | NR_028035.4 | 20.4% | (many diffs) | |
| 17 | human | 355 | FAS | Fas cell surface death rece... | NR_135315.2 | 19.8% | (many diffs) | |
| 18 | human | 355 | FAS | Fas cell surface death rece... | NR_028034.4 | 18.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1071
- ORF length:
- 1005
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgct gggcatctgg accctcctac ctctggttct tacgtctgtt gctagattat 121 cgtccaaaag tgttaatgcc caagtgactg acatcaactc caagggattg gaattgagga 181 agactgttac tacagttgag actcagaact tggaaggcct gcatcatgat ggccaattct 241 gccataagcc ctgtcctcca ggtgaaagga aagctaggga ctgcacagtc aatggggatg 301 aaccagactg cgtgccctgc caagaaggga aggagtacac agacaaagcc catttttctt 361 ccaaatgcag aagatgtaga ttgtgtgatg aaggacatgg cttagaagtg gaaataaact 421 gcacccggac ccagaatacc aagtgcagat gtaaaccaaa ctttttttgt aactctactg 481 tatgtgaaca ctgtgaccct tgcaccaaat gtgaacatgg aatcatcaag gaatgcacac 541 tcaccagcaa caccaagtgc aaagaggaag gatccagatc taacttgggg tggctttgtc 601 ttcttctttt gccaattcca ctaattgttt gggtgaagag aaaggaagta cagaaaacat 661 gcagaaagca cagaaaggaa aaccaaggtt ctcatgaatc tccaacctta aatcctgaaa 721 cagtggcaat aaatttatct gatgttgact tgagtaaata tatcaccact attgctGGAG 781 TCATGACACT AAGTCAAGTT AAAGGCTTTG TTCGAAAGAA TGGTGTCAAT GAAGCCAAAA 841 TAGATGAGAT CAAGAATGAC AATGTCCAAG ACACAGCAGA ACAGAAAGTT CAACTGCTTC 901 GTAATTGGCA TCAACTTCAT GGAAAGAAAG AAGCGTATGA CACATTGATT AAAGATCTCA 961 AAAAAGCCAA TCTTTGTACT CTTGCAGAGA AAATTCAGAC TATCATCCTC AAGGACATTA 1021 CTAGTGACTC AGAAAATTCA AACTTCAGAA ATGAAATCCA AAGCTTGGTC TACCCAACTT 1081 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 1141 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 1201 CTTGTGGAAA GGACGACAAG CTTGTATCCC TCCGATAAAA ACGCGTTAAG TCgacaatca 1261 acctctggat tacaaaattt gtgaaagatt