Transcript: Human NM_152872.4

Homo sapiens Fas cell surface death receptor (FAS), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
FAS (355)
Length:
3671
CDS:
80..742

Additional Resources:

NCBI RefSeq record:
NM_152872.4
NBCI Gene record:
FAS (355)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152872.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000038694 GCGTATGACACATTGATTAAA pLKO.1 922 3UTR 100% 15.000 21.000 N FAS n/a
2 TRCN0000038696 GTGCAGATGTAAACCAAACTT pLKO.1 457 CDS 100% 5.625 7.875 N FAS n/a
3 TRCN0000038695 GTTGCTAGATTATCGTCCAAA pLKO.1 122 CDS 100% 4.950 3.960 N FAS n/a
4 TRCN0000218492 CTATCATCCTCAAGGACATTA pLKO_005 989 3UTR 100% 13.200 9.240 N FAS n/a
5 TRCN0000038698 GCAAAGAGGAAGGATCCAGAT pLKO.1 573 CDS 100% 4.050 2.835 N FAS n/a
6 TRCN0000255407 TTAAATTATAATGTTTGACTA pLKO_005 1692 3UTR 100% 0.000 0.000 N FAS n/a
7 TRCN0000255406 CCCTTGTGTTTGGAATTATAA pLKO_005 2337 3UTR 100% 15.000 9.000 N FAS n/a
8 TRCN0000255408 ATATCTTTGAAAGTTTGTATT pLKO_005 2194 3UTR 100% 0.000 0.000 N FAS n/a
9 TRCN0000265627 TTTTACTGGGTACATTTTATC pLKO_005 1149 3UTR 100% 0.000 0.000 N FAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152872.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00087 pDONR223 100% 65.5% 64.7% None 642T>C;651_652ins25;660_661ins320 n/a
2 TRCN0000472480 CAAGCTTGTATCCCTCCGATAAAA pLX_317 29.7% 65.5% 64.7% V5 642T>C;651_652ins25;660_661ins320 n/a
3 ccsbBroad304_00087 pLX_304 68.9% 51.2% 42.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV