Transcript: Human XM_006717819.3

PREDICTED: Homo sapiens Fas cell surface death receptor (FAS), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FAS (355)
Length:
7343
CDS:
4920..6008

Additional Resources:

NCBI RefSeq record:
XM_006717819.3
NBCI Gene record:
FAS (355)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006717819.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000038694 GCGTATGACACATTGATTAAA pLKO.1 5868 CDS 100% 15.000 21.000 N FAS n/a
2 TRCN0000038696 GTGCAGATGTAAACCAAACTT pLKO.1 5378 CDS 100% 5.625 7.875 N FAS n/a
3 TRCN0000038695 GTTGCTAGATTATCGTCCAAA pLKO.1 5043 CDS 100% 4.950 3.960 N FAS n/a
4 TRCN0000038697 CCTGAAACAGTGGCAATAAAT pLKO.1 5649 CDS 100% 15.000 10.500 N FAS n/a
5 TRCN0000218492 CTATCATCCTCAAGGACATTA pLKO_005 5935 CDS 100% 13.200 9.240 N FAS n/a
6 TRCN0000038698 GCAAAGAGGAAGGATCCAGAT pLKO.1 5494 CDS 100% 4.050 2.835 N FAS n/a
7 TRCN0000255407 TTAAATTATAATGTTTGACTA pLKO_005 6638 3UTR 100% 0.000 0.000 N FAS n/a
8 TRCN0000255406 CCCTTGTGTTTGGAATTATAA pLKO_005 7283 3UTR 100% 15.000 9.000 N FAS n/a
9 TRCN0000255408 ATATCTTTGAAAGTTTGTATT pLKO_005 7140 3UTR 100% 0.000 0.000 N FAS n/a
10 TRCN0000265627 TTTTACTGGGTACATTTTATC pLKO_005 6095 3UTR 100% 0.000 0.000 N FAS n/a
11 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 3665 5UTR 100% 4.950 2.475 Y n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006717819.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00087 pDONR223 100% 91.6% 90.3% None (many diffs) n/a
2 TRCN0000472480 CAAGCTTGTATCCCTCCGATAAAA pLX_317 29.7% 91.6% 90.3% V5 (many diffs) n/a
Download CSV