Construct: ORF TRCN0000472557
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009346.1_s317c1
- Derived from:
- ccsbBroadEn_02197
- DNA Barcode:
- ATTATTAAGATATATTCTCAAAGA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- VPS26A (9559)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472557
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 9559 | VPS26A | VPS26, retromer complex com... | NM_004896.5 | 100% | 100% | |
| 2 | human | 9559 | VPS26A | VPS26, retromer complex com... | NM_001318945.2 | 88% | 82.5% | (many diffs) |
| 3 | human | 9559 | VPS26A | VPS26, retromer complex com... | NM_001318944.2 | 88% | 80.8% | (many diffs) |
| 4 | human | 9559 | VPS26A | VPS26, retromer complex com... | NM_001035260.2 | 76.7% | 74.3% | 725_726ins143;753_754ins85 |
| 5 | human | 9559 | VPS26A | VPS26, retromer complex com... | NM_001318946.2 | 66% | 66% | 0_1ins333 |
| 6 | mouse | 30930 | Vps26a | VPS26 retromer complex comp... | NM_133672.3 | 91.1% | 99% | (many diffs) |
| 7 | mouse | 30930 | Vps26a | VPS26 retromer complex comp... | NM_001113355.1 | 82.9% | 89.9% | (many diffs) |
| 8 | mouse | 30930 | Vps26a | VPS26 retromer complex comp... | NM_001358543.1 | 59.1% | 65.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1047
- ORF length:
- 981
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgag ttttcttgga ggcttttttg gtccaatttg tgagatcgat attgttctta 121 atgatgggga aaccaggaaa atggcagaaa tgaaaactga agatggcaaa gtagaaaaac 181 actatctctt ctatgacgga gaatccgttt caggaaaggt aaacctagcc tttaagcaac 241 ctggaaagag gctagaacac caaggaatta gaattgaatt tgtaggtcaa attgaacttt 301 tcaatgacaa gagtaatact catgaatttg taaacctagt gaaagaacta gccttacctg 361 gagaactgac tcagagcaga agttatgatt ttgaatttat gcaagttgaa aagccatatg 421 aatcttacat cggtgccaat gtccgcttga ggtattttct taaagtgaca atagtgagaa 481 gactgacaga tttggtaaaa gagtatgatc TTATTGTTCA CCAGCTTGCC ACCTATCCTG 541 ATGTTAACAA CTCTATTAAG ATGGAAGTGG GCATTGAAGA TTGTCTACAT ATAGAATTTG 601 AATATAATAA ATCAAAGTAT CATTTAAAGG ATGTGATTGT TGGAAAAATT TACTTCTTAT 661 TAGTAAGAAT AAAAATACAA CATATGGAGT TACAGCTGAT CAAAAAAGAG ATCACAGGAA 721 TTGGACCCAG TACCACAACA GAAACAGAAA CAATCGCCAA ATATGAAATA ATGGATGGTG 781 CACCAGTAAA AGGTGAATCA ATTCCAATAA GGCTATTTTT AGCAGGATAT GACCCAACTC 841 CAACAATGAG AGATGTGAAC AAAAAATTTT CAGTAAGGTA CTTTTTGAAT TTAGTGCTTG 901 TTGATGAGGA AGACCGGAGG TACTTCAAAC AGCAGGAGAT AATTTTATGG AGAAAAGCTC 961 CTGAAAAACT GAGGAAACAG AGAACAAACT TTCACCAGCG ATTTGAATCT CCAGAATCAC 1021 AGGCATCTGC CGAACAGCCT GAAATGTGCC CAACTTTCTT GTACAAAGTG GTTGATATCG 1081 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 1141 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GAATTATTAA 1201 GATATATTCT CAAAGAACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 1261 aagatt