Transcript: Human NM_004896.5

Homo sapiens VPS26, retromer complex component A (VPS26A), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
VPS26A (9559)
Length:
4227
CDS:
101..1084

Additional Resources:

NCBI RefSeq record:
NM_004896.5
NBCI Gene record:
VPS26A (9559)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004896.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000375433 AGAGTAATACTCATGAATTTG pLKO_005 345 CDS 100% 13.200 18.480 N Vps26a n/a
2 TRCN0000382393 AGAGTAATACTCATGAATTTG pLKO_005 345 CDS 100% 13.200 18.480 N VPS26A n/a
3 TRCN0000065138 CCAATTTGTGAGATCGATATT pLKO.1 128 CDS 100% 13.200 18.480 N VPS26A n/a
4 TRCN0000382035 ACAAACTTTCACCAGCGATTT pLKO_005 1019 CDS 100% 10.800 15.120 N VPS26A n/a
5 TRCN0000065141 GAAAGGTAAACCTAGCCTTTA pLKO.1 249 CDS 100% 1.080 1.512 N VPS26A n/a
6 TRCN0000380140 TCAATTCCAATAAGGCTATTT pLKO_005 833 CDS 100% 13.200 10.560 N VPS26A n/a
7 TRCN0000379596 ATGTGAGTAGGCTGGTATTTG pLKO_005 1391 3UTR 100% 13.200 9.240 N VPS26A n/a
8 TRCN0000380690 CAATTTGTGAGATCGATATTG pLKO_005 129 CDS 100% 13.200 9.240 N VPS26A n/a
9 TRCN0000379550 CATTGAAGATTGTCTACATAT pLKO_005 607 CDS 100% 13.200 9.240 N VPS26A n/a
10 TRCN0000065142 CCTGATGTTAACAACTCTATT pLKO.1 572 CDS 100% 13.200 9.240 N VPS26A n/a
11 TRCN0000380477 GGCTAATGATTACCTCTTATT pLKO_005 1462 3UTR 100% 13.200 9.240 N VPS26A n/a
12 TRCN0000065139 GAACAAACTTTCACCAGCGAT pLKO.1 1017 CDS 100% 2.640 1.848 N VPS26A n/a
13 TRCN0000065140 GATCTTATTGTTCACCAGCTT pLKO.1 542 CDS 100% 2.640 1.848 N VPS26A n/a
14 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 3552 3UTR 100% 4.950 2.475 Y ERAP2 n/a
15 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3553 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004896.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02197 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02197 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000472557 ATTATTAAGATATATTCTCAAAGA pLX_317 54.6% 100% 100% V5 n/a
Download CSV