Transcript: Mouse NM_001358543.1

Mus musculus VPS26 retromer complex component A (Vps26a), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Mus musculus (mouse)
Gene:
Vps26a (30930)
Length:
2955
CDS:
403..1053

Additional Resources:

NCBI RefSeq record:
NM_001358543.1
NBCI Gene record:
Vps26a (30930)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001358543.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000366610 CAATCGCTAAGTATGAAATAA pLKO_005 755 CDS 100% 15.000 21.000 N Vps26a n/a
2 TRCN0000115332 CCTGATGTCAACAACTCTATT pLKO.1 541 CDS 100% 13.200 18.480 N Vps26a n/a
3 TRCN0000375433 AGAGTAATACTCATGAATTTG pLKO_005 314 5UTR 100% 13.200 10.560 N Vps26a n/a
4 TRCN0000382393 AGAGTAATACTCATGAATTTG pLKO_005 314 5UTR 100% 13.200 10.560 N VPS26A n/a
5 TRCN0000366609 AGTGAAAGAGTACGATCTTAT pLKO_005 498 CDS 100% 13.200 10.560 N Vps26a n/a
6 TRCN0000375434 AGGAGAATCTATTCCGATAAG pLKO_005 795 CDS 100% 10.800 8.640 N Vps26a n/a
7 TRCN0000366611 TCCTAGAGTGCTGCGTTTATT pLKO_005 1165 3UTR 100% 15.000 10.500 N Vps26a n/a
8 TRCN0000115334 CTGCACATAGAGTTTGAATAT pLKO.1 589 CDS 100% 13.200 9.240 N Vps26a n/a
9 TRCN0000375508 TAAGCACTCAGAAGCATAAAC pLKO_005 1295 3UTR 100% 13.200 9.240 N Vps26a n/a
10 TRCN0000115333 CCCATTTGTGAGATTGATGTT pLKO.1 173 5UTR 100% 4.950 3.465 N Vps26a n/a
11 TRCN0000115335 GCACCACAACAGAGACAGAAA pLKO.1 734 CDS 100% 4.950 2.970 N Vps26a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001358543.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02197 pDONR223 100% 59.1% 65.7% None (many diffs) n/a
2 ccsbBroad304_02197 pLX_304 0% 59.1% 65.7% V5 (many diffs) n/a
3 TRCN0000472557 ATTATTAAGATATATTCTCAAAGA pLX_317 54.6% 59.1% 65.7% V5 (many diffs) n/a
Download CSV