Construct: ORF TRCN0000472563
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009280.1_s317c1
- Derived from:
- ccsbBroadEn_01391
- DNA Barcode:
- CTATGCAGAGATGATTTTGATCGG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RFC5 (5985)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472563
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5985 | RFC5 | replication factor C subunit 5 | NM_007370.7 | 100% | 100% | |
| 2 | human | 5985 | RFC5 | replication factor C subunit 5 | XM_011538643.3 | 100% | 100% | |
| 3 | human | 5985 | RFC5 | replication factor C subunit 5 | XM_011538645.3 | 100% | 100% | |
| 4 | human | 5985 | RFC5 | replication factor C subunit 5 | NM_001206801.2 | 99.1% | 98.8% | 793_794insATATTACAG |
| 5 | human | 5985 | RFC5 | replication factor C subunit 5 | NM_001130113.2 | 93.8% | 93.5% | 0_1ins48;2_3insCAGGAACCTGCCCTG |
| 6 | human | 5985 | RFC5 | replication factor C subunit 5 | NM_181578.4 | 93.8% | 93.5% | 0_1ins48;2_3insCAGGAACCTGCCCTG |
| 7 | human | 5985 | RFC5 | replication factor C subunit 5 | XM_024449118.1 | 93.8% | 93.5% | 0_1ins48;2_3insCAGGAACCTGCCCTG |
| 8 | human | 5985 | RFC5 | replication factor C subunit 5 | XM_017019779.2 | 88.5% | 85% | (many diffs) |
| 9 | human | 5985 | RFC5 | replication factor C subunit 5 | NM_001130112.3 | 75% | 75% | 0_1ins255 |
| 10 | human | 5985 | RFC5 | replication factor C subunit 5 | XM_024449119.1 | 75% | 75% | 0_1ins255 |
| 11 | human | 5985 | RFC5 | replication factor C subunit 5 | NM_001346815.1 | 74.1% | 73.8% | 0_1ins255;538_539insATATTACAG |
| 12 | human | 5985 | RFC5 | replication factor C subunit 5 | NR_144504.1 | 47% | 1_167del;748_751delAGTG;1192_2166del | |
| 13 | mouse | 72151 | Rfc5 | replication factor C (activ... | NM_028128.1 | 86.4% | 93.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1086
- ORF length:
- 1020
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga gacctcagca ctcaagcagc aggagcagcc cgcggcgacc aagatcagga 121 acctgccctg ggttgaaaaa taccggccac agaccctgaa tgatctcatt tctcatcagg 181 acattctgag taccattcag aagtttatca atgaagaccg actgccacac ttgcttctct 241 acggtccccc agggacaggc aagacatcta ccatcctagc ctgtgcgaaa cagctatata 301 aagacaaaga atttggctcc atggtcttgg agctgaatgc ttcagatgac cgaggaatag 361 acatcattcg aggaccgatc ctgagctttg ctagcacaag gacaatattt aagaaaggct 421 ttaagctagt gatcttggat gaagcagacg ccatgactca ggacgcccag aatgccttga 481 gaagagtaat tgagaaattc acagaaaata ccagattctg cctcatctgt aactatctgt 541 caaagatcat ccctgccttg cagtcccgct gcacgaggtt tcggttcggt cccctgactc 601 ctgaactcat ggttccccgc cTGGAACATG TCGTGGAAGA AGAGAAAGTT GATATAAGTG 661 AAGATGGAAT GAAAGCACTA GTCACTCTTT CCAGTGGAGA CATGCGTAGG GCTCTGAACA 721 TTTTGCAGAG CACCAATATG GCCTTTGGGA AGGTGACAGA GGAGACTGTC TACACCTGCA 781 CCGGGCACCC GCTCAAGTCA GACATTGCCA ACATCCTGGA CTGGATGTTG AATCAAGATT 841 TCACCACAGC CTACAGAAAT ATTACAGAGT TGAAAACTCT GAAGGGGTTG GCACTGCATG 901 ATATCCTGAC AGAGATACAC TTGTTTGTGC ATAGAGTTGA CTTTCCATCT TCAGTTCGAA 961 TACATTTATT GACCAAAATG GCAGACATTG AGTACAGGCT TTCTGTTGGC ACCAACGAGA 1021 AGATCCAGCT GAGCTCCCTC ATTGCTGCAT TTCAAGTCAC CAGAGACCTG ATTGTTGCAG 1081 AGGCCTACCC AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 1141 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 1201 CTTGGCTTTA TATATCTTGT GGAAAGGACG ACTATGCAGA GATGATTTTG ATCGGACGCG 1261 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt