Transcript: Mouse NM_028128.1

Mus musculus replication factor C (activator 1) 5 (Rfc5), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Rfc5 (72151)
Length:
1750
CDS:
46..1065

Additional Resources:

NCBI RefSeq record:
NM_028128.1
NBCI Gene record:
Rfc5 (72151)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028128.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000225748 GACGACCGAGGGATCGATATT pLKO_005 322 CDS 100% 13.200 18.480 N Rfc5 n/a
2 TRCN0000225750 AGACGGACATTGCCAATATAC pLKO_005 773 CDS 100% 13.200 9.240 N Rfc5 n/a
3 TRCN0000225751 AGGGCAACTTTAATCCATAAT pLKO_005 1204 3UTR 100% 13.200 9.240 N Rfc5 n/a
4 TRCN0000218845 CTTCAGTTCGGATACACTTAT pLKO_005 926 CDS 100% 13.200 9.240 N Rfc5 n/a
5 TRCN0000225749 ACGCCTTGAGACGAGTGATTG pLKO_005 449 CDS 100% 10.800 7.560 N Rfc5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028128.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01391 pDONR223 100% 86.4% 93.8% None (many diffs) n/a
2 ccsbBroad304_01391 pLX_304 0% 86.4% 93.8% V5 (many diffs) n/a
3 TRCN0000472563 CTATGCAGAGATGATTTTGATCGG pLX_317 45.6% 86.4% 93.8% V5 (many diffs) n/a
Download CSV