Transcript: Human NM_001130113.2

Homo sapiens replication factor C subunit 5 (RFC5), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
RFC5 (5985)
Length:
2221
CDS:
290..1249

Additional Resources:

NCBI RefSeq record:
NM_001130113.2
NBCI Gene record:
RFC5 (5985)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001130113.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000157056 GCAGACATTGAGTACAGGCTT pLKO.1 1142 CDS 100% 2.640 3.696 N RFC5 n/a
2 TRCN0000352969 GCAGACATTGAGTACAGGCTT pLKO_005 1142 CDS 100% 2.640 3.696 N RFC5 n/a
3 TRCN0000151566 GAATGCCTTGAGAAGAGTAAT pLKO.1 631 CDS 100% 13.200 9.240 N RFC5 n/a
4 TRCN0000344069 GAATGCCTTGAGAAGAGTAAT pLKO_005 631 CDS 100% 13.200 9.240 N RFC5 n/a
5 TRCN0000158116 CAGAGGACAGTTCCAGGATAA pLKO.1 1300 3UTR 100% 10.800 7.560 N RFC5 n/a
6 TRCN0000344070 CAGAGGACAGTTCCAGGATAA pLKO_005 1300 3UTR 100% 10.800 7.560 N RFC5 n/a
7 TRCN0000156837 GTCACCAGAGACCTGATTGTT pLKO.1 1217 CDS 100% 5.625 3.938 N RFC5 n/a
8 TRCN0000150544 GAAAGGCTTTAAGCTAGTGAT pLKO.1 574 CDS 100% 4.950 3.465 N RFC5 n/a
9 TRCN0000344068 GAAAGGCTTTAAGCTAGTGAT pLKO_005 574 CDS 100% 4.950 3.465 N RFC5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001130113.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01391 pDONR223 100% 93.8% 93.5% None 0_1ins48;2_3insCAGGAACCTGCCCTG n/a
2 ccsbBroad304_01391 pLX_304 0% 93.8% 93.5% V5 0_1ins48;2_3insCAGGAACCTGCCCTG n/a
3 TRCN0000472563 CTATGCAGAGATGATTTTGATCGG pLX_317 45.6% 93.8% 93.5% V5 0_1ins48;2_3insCAGGAACCTGCCCTG n/a
Download CSV