Construct: ORF TRCN0000472634
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF012912.1_s317c1
- Derived from:
- ccsbBroadEn_00733
- DNA Barcode:
- GCCGGCTACCCCAGCCCCGTCAGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- HCK (3055)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472634
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 3055 | HCK | HCK proto-oncogene, Src fam... | NM_001172129.2 | 100% | 100% | |
| 2 | human | 3055 | HCK | HCK proto-oncogene, Src fam... | NM_001172133.2 | 100% | 100% | |
| 3 | human | 3055 | HCK | HCK proto-oncogene, Src fam... | NM_001172132.2 | 99.8% | 99.8% | 1_3delATG |
| 4 | human | 3055 | HCK | HCK proto-oncogene, Src fam... | NM_001172131.2 | 99.8% | 99.8% | 162_163insGCA |
| 5 | human | 3055 | HCK | HCK proto-oncogene, Src fam... | NM_002110.4 | 96% | 96% | 1_63del |
| 6 | human | 3055 | HCK | HCK proto-oncogene, Src fam... | NM_001172130.2 | 95.8% | 95.8% | 1_63del;225_226insGCA |
| 7 | mouse | 15162 | Hck | hemopoietic cell kinase | NM_001172117.1 | 86.2% | 89.7% | (many diffs) |
| 8 | mouse | 15162 | Hck | hemopoietic cell kinase | NM_010407.4 | 82.7% | 86.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1581
- ORF length:
- 1515
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggg gtgcatgaag tccaagttcc tccaggtcgg aggcaataca ttctcaaaaa 121 ctgaaaccag cgccagccca cactgtcctg tgtacgtgcc ggatcccaca tccaccatca 181 agccggggcc taatagccac aacagcaaca caccaggaat cagggaggca ggctctgagg 241 acatcatcgt ggttgccctg tatgattacg aggccattca ccacgaagac ctcagcttcc 301 agaaggggga ccagatggtg gtcctagagg aatccgggga gtggtggaag gctcgatccc 361 tggccacccg gaaggagggc tacatcccaa gcaactatgt cgcccgcgtt gactctctgg 421 agacagagga gtggtttttc aagggcatca gccggaagga cgcagagcgc caactgctgg 481 ctcccggcaa catgctgggc tccttcatga tccgggatag cgagaccact aaaggaagct 541 actctttgtc cgtgcgagac tacgaccctc ggcagggaga taccgtgaaa cattacaaga 601 tccggaccct ggacaacggg ggcttctaca tatccccccg aagcaccttc agcactctgc 661 aggagctggt ggaccactac aagaagggga acgacgggct ctgccagaaa ctgtcggtgc 721 cctgcatgtc ttccaagccc cagaagcctt gggagaaaga tgcctgggag atccctcggg 781 aatccctcaa gctggagaag aaacttggag ctgggcagtt tggggaagtc tggatggcca 841 cctacaacaa gcacaccaag gtggcagtga agacgatgaa gccagggagc atgtcggtgg 901 aggccttcct ggcagaggcc aacgtgatga aaactctgca gcatgacaag ctggtcaaac 961 ttcatgcggt ggtcaccaag gagcccatct acatcatcac ggagttcatg gccaaaggaa 1021 gcttgctgga ctttctgaaa agtgatgagg gcagcaagca gccattgcca aaactcattg 1081 acttctcagc ccagattgca gaaggcatgg ccttcatcga gcagaggaac tacatccacc 1141 gagacctccg agctgccaac atcttggtct ctgcatcccT GGTGTGTAAG ATTGCTGACT 1201 TTGGCCTGGC CCGGGTCATT GAGGACAACG AGTACACGGC TCGGGAAGGG GCCAAGTTCC 1261 CCATCAAGTG GACAGCTCCT GAAGCCATCA ACTTTGGCTC CTTCACCATC AAGTCAGACG 1321 TCTGGTCCTT TGGTATCCTG CTGATGGAGA TCGTCACCTA CGGCCGGATC CCTTACCCAG 1381 GGATGTCAAA CCCTGAAGTG ATCCGAGCTC TGGAGCGTGG ATACCGGATG CCTCGCCCAG 1441 AGAACTGCCC AGAGGAGCTC TACAACATCA TGATGCGCTG CTGGAAAAAC CGTCCGGAGG 1501 AGCGGCCGAC CTTCGAATAC ATCCAGAGTG TGCTGGATGA CTTCTACACG GCCACAGAGA 1561 GCCAGTACCA ACAGCAGCCA TGCCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 1621 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 1681 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGAGCCG GCTACCCCAG 1741 CCCCGTCAGT ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt