Transcript: Mouse NM_010407.4

Mus musculus hemopoietic cell kinase (Hck), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Hck (15162)
Length:
2107
CDS:
226..1800

Additional Resources:

NCBI RefSeq record:
NM_010407.4
NBCI Gene record:
Hck (15162)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010407.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000361285 CCGTATGCCTCGACCAGATAA pLKO_005 1641 CDS 100% 13.200 10.560 N Hck n/a
2 TRCN0000361283 GACACCGTGAAGCACTATAAG pLKO_005 796 CDS 100% 13.200 9.240 N Hck n/a
3 TRCN0000361284 CTCCTGAAGCCATCAACTTTG pLKO_005 1493 CDS 100% 10.800 7.560 N Hck n/a
4 TRCN0000368910 TGTGTAAGATTGCTGACTTTG pLKO_005 1400 CDS 100% 10.800 7.560 N HCK n/a
5 TRCN0000023536 GCATCACTGGTGTGTAAGATT pLKO.1 1390 CDS 100% 5.625 3.938 N Hck n/a
6 TRCN0000023534 GCACGAATCATCGAGGACAAT pLKO.1 1426 CDS 100% 4.950 3.465 N Hck n/a
7 TRCN0000023537 CATGACAAACTGGTGAAGCTA pLKO.1 1159 CDS 100% 3.000 2.100 N Hck n/a
8 TRCN0000023535 CTGTACGACTATGAGGCTATT pLKO.1 475 CDS 100% 10.800 6.480 N Hck n/a
9 TRCN0000023538 ACCTACAACAAGCACACCAAA pLKO.1 1057 CDS 100% 4.950 2.970 N Hck n/a
10 TRCN0000379408 TTGACTTCTCAGCCCAGATTG pLKO_005 1295 CDS 100% 10.800 6.480 N HCK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010407.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14664 pDONR223 0% 86.2% 86.1% None (many diffs) n/a
2 ccsbBroad304_14664 pLX_304 0% 86.2% 86.1% V5 (many diffs) n/a
3 TRCN0000473288 CAGAATGGGGCTAGTTGGCACACT pLX_317 26.2% 86.2% 86.1% V5 (many diffs) n/a
4 ccsbBroadEn_00733 pDONR223 100% 82.7% 86.1% None (many diffs) n/a
5 ccsbBroad304_00733 pLX_304 0% 82.7% 86.1% V5 (many diffs) n/a
6 TRCN0000472634 GCCGGCTACCCCAGCCCCGTCAGT pLX_317 26.8% 82.7% 86.1% V5 (many diffs) n/a
7 TRCN0000488410 GAAAAAACTCCATAACCTACTATG pLX_317 17.5% 82.5% 85.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV