Transcript: Human NM_001172129.2

Homo sapiens HCK proto-oncogene, Src family tyrosine kinase (HCK), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-09
Taxon:
Homo sapiens (human)
Gene:
HCK (3055)
Length:
2088
CDS:
247..1764

Additional Resources:

NCBI RefSeq record:
NM_001172129.2
NBCI Gene record:
HCK (3055)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001172129.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000379914 GGGAGATACCGTGAAACATTA pLKO_005 756 CDS 100% 13.200 18.480 N HCK n/a
2 TRCN0000195026 CAATCTGACATTCTCAGGAAG pLKO.1 1950 3UTR 100% 4.050 5.670 N HCK n/a
3 TRCN0000009967 GGTCAAACTTCATGCGGTGGT pLKO.1 1134 CDS 100% 2.160 3.024 N HCK n/a
4 TRCN0000009971 CAGGGAGATACCGTGAAACAT pLKO.1 754 CDS 100% 5.625 4.500 N HCK n/a
5 TRCN0000320534 CGTGGTTGCCCTGTATGATTA pLKO_005 429 CDS 100% 13.200 9.240 N HCK n/a
6 TRCN0000361284 CTCCTGAAGCCATCAACTTTG pLKO_005 1457 CDS 100% 10.800 7.560 N Hck n/a
7 TRCN0000368910 TGTGTAAGATTGCTGACTTTG pLKO_005 1364 CDS 100% 10.800 7.560 N HCK n/a
8 TRCN0000379408 TTGACTTCTCAGCCCAGATTG pLKO_005 1259 CDS 100% 10.800 7.560 N HCK n/a
9 TRCN0000009968 CCAGGTCGGAGGCAATACATT pLKO.1 273 CDS 100% 5.625 3.938 N HCK n/a
10 TRCN0000320597 CCAGGTCGGAGGCAATACATT pLKO_005 273 CDS 100% 5.625 3.938 N HCK n/a
11 TRCN0000009970 ATCATCGTGGTTGCCCTGTAT pLKO.1 424 CDS 100% 4.950 3.465 N HCK n/a
12 TRCN0000381826 ATCGAGCAGAGGAACTACATC pLKO_005 1297 CDS 100% 4.950 3.465 N HCK n/a
13 TRCN0000199328 CTGATGGAGATCGTCACCTAC pLKO.1 1522 CDS 100% 4.050 2.835 N HCK n/a
14 TRCN0000320535 TACCAACAGCAGCCATGATAG pLKO_005 1747 CDS 100% 0.000 0.000 N HCK n/a
15 TRCN0000320599 GCAATCCACAATCTGACATTC pLKO_005 1942 3UTR 100% 10.800 6.480 N HCK n/a
16 TRCN0000009969 CAACAGCAACACACCAGGAAT pLKO.1 381 CDS 100% 4.950 2.970 N HCK n/a
17 TRCN0000023538 ACCTACAACAAGCACACCAAA pLKO.1 1021 CDS 100% 4.950 3.465 N Hck n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001172129.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00733 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00733 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000472634 GCCGGCTACCCCAGCCCCGTCAGT pLX_317 26.8% 100% 100% V5 n/a
4 TRCN0000488410 GAAAAAACTCCATAACCTACTATG pLX_317 17.5% 99.6% 99.6% V5 (not translated due to prior stop codon) 8_9delGCinsCG;1515_1516insTTG n/a
5 ccsbBroadEn_14664 pDONR223 0% 96% 100% None 0_1ins63 n/a
6 ccsbBroad304_14664 pLX_304 0% 96% 100% V5 0_1ins63 n/a
7 TRCN0000473288 CAGAATGGGGCTAGTTGGCACACT pLX_317 26.2% 96% 100% V5 0_1ins63 n/a
Download CSV