Construct: ORF TRCN0000472638
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF005889.1_s317c1
- Derived from:
- ccsbBroadEn_05702
- DNA Barcode:
- CATTTTGTAGGCCCATAGTGCACT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PEF1 (553115)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472638
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 553115 | PEF1 | penta-EF-hand domain contai... | NM_012392.4 | 100% | 100% | |
| 2 | human | 553115 | PEF1 | penta-EF-hand domain contai... | XM_011541745.1 | 97.7% | 97.5% | 0_1insATGGCCAGCT;2_3insCCTTACC;4_5delAA |
| 3 | human | 553115 | PEF1 | penta-EF-hand domain contai... | NM_001359651.1 | 75.3% | 75.3% | 0_1ins210 |
| 4 | human | 553115 | PEF1 | penta-EF-hand domain contai... | XM_011541746.2 | 75.3% | 75.3% | 0_1ins210 |
| 5 | human | 553115 | PEF1 | penta-EF-hand domain contai... | XM_011541747.1 | 75.3% | 75.3% | 0_1ins210 |
| 6 | human | 553115 | PEF1 | penta-EF-hand domain contai... | XM_017001680.1 | 75.3% | 75.3% | 0_1ins210 |
| 7 | human | 553115 | PEF1 | penta-EF-hand domain contai... | XM_017001681.1 | 64% | 62.3% | (many diffs) |
| 8 | human | 553115 | PEF1 | penta-EF-hand domain contai... | NR_033686.2 | 34.5% | (many diffs) | |
| 9 | mouse | 67898 | Pef1 | penta-EF hand domain contai... | NM_026441.4 | 83.6% | 84.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 918
- ORF length:
- 852
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc cagctatcct taccggcagg gctgcccagg agctgcagga caagcaccag 121 gagcccctcc gggtagctac taccctggac cccccaatag tggagggcag tatggtagtg 181 ggctaccccc tggtggtggt tatgggggtc ctgcccctgg agggccttat ggaccaccag 241 ctggtggagg gccctatgga caccccaatc ctgggatgtt cccctctgga actccaggag 301 gaccatatgg cggtgcagct cccgggggcc cctatggtca gccacctcca agttcctacg 361 gtgcccagca gcctgggctt tatggacagg gtggcgcccc tcccaatgtg gatcctgagg 421 cctactcctg gttccagtcg gtggactcag atcacagtgg ctatatctcc atgaaggagc 481 taaagcaggc cctggtcaac tgcaattggt cttcattcaa tgatgagacc tgcctcatga 541 tgataaacat gtttgacaag accaagtcag gccgcatcga tgtcTACGGC TTCTCAGCCC 601 TGTGGAAATT CATCCAGCAG TGGAAGAACC TCTTCCAGCA GTATGACCGG GACCGCTCGG 661 GCTCCATTAG CTACACAGAG CTGCAGCAAG CTCTGTCCCA AATGGGCTAC AACCTGAGCC 721 CCCAGTTCAC CCAGCTTCTG GTCTCCCGCT ACTGCCCACG CTCTGCCAAT CCTGCCATGC 781 AGCTTGACCG CTTCATCCAG GTGTGCACCC AGCTGCAGGT GCTGACAGAG GCCTTCCGGG 841 AGAAGGACAC AGCTGTACAA GGCAACATTC GGCTCAGCTT CGAGGACTTC GTCACCATGA 901 CAGCTTCTCG GATGCTATGC CCAACTTTCT TGTACAAAGT GGTTGATATC GGTAAGCCTA 961 TCCCTAACCC TCTCCTCGGT CTCGATTCTA CGTAGTAATG AACTAGTCCG TAACTTGAAA 1021 GTTTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GACATTTTGT AGGCCCATAG 1081 TGCACTACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga aagatt