Transcript: Mouse NM_026441.4

Mus musculus penta-EF hand domain containing 1 (Pef1), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Pef1 (67898)
Length:
1551
CDS:
72..899

Additional Resources:

NCBI RefSeq record:
NM_026441.4
NBCI Gene record:
Pef1 (67898)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026441.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000295436 TACTGCGCACGCTCTGCTATT pLKO_005 729 CDS 100% 10.800 15.120 N Pef1 n/a
2 TRCN0000295435 GTACCCAGCCTGGACATTATG pLKO_005 343 CDS 100% 0.000 0.000 N Pef1 n/a
3 TRCN0000104662 CAGTGGCTATATCTCCCTCAA pLKO.1 434 CDS 100% 4.050 3.240 N Pef1 n/a
4 TRCN0000295377 ATTCTGCCATCTCGGCCATAT pLKO_005 1323 3UTR 100% 10.800 7.560 N Pef1 n/a
5 TRCN0000055955 CCTCATGATGATAAACATGTT pLKO.1 512 CDS 100% 4.950 3.465 N PEF1 n/a
6 TRCN0000286664 CCTCATGATGATAAACATGTT pLKO_005 512 CDS 100% 4.950 3.465 N PEF1 n/a
7 TRCN0000104661 CCTCATTCAATGACGAGACAT pLKO.1 490 CDS 100% 4.950 3.465 N Pef1 n/a
8 TRCN0000288098 CCTCATTCAATGACGAGACAT pLKO_005 490 CDS 100% 4.950 3.465 N Pef1 n/a
9 TRCN0000104663 GCAGCTTGACTGCTTCATCAA pLKO.1 758 CDS 100% 4.950 3.465 N Pef1 n/a
10 TRCN0000295378 AGCAGTGGAGGAACCTCTTTC pLKO_005 595 CDS 100% 10.800 6.480 N Pef1 n/a
11 TRCN0000104664 GCTCTCCCAGATGGGCTACAA pLKO.1 671 CDS 100% 1.650 0.990 N Pef1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026441.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10182 pDONR223 100% 83.8% 84.1% None (many diffs) n/a
2 ccsbBroad304_10182 pLX_304 0% 83.8% 84.1% V5 (many diffs) n/a
3 TRCN0000475874 GATTGGCAGATATTATCGAAGTCG pLX_317 35% 83.8% 84.1% V5 (many diffs) n/a
4 ccsbBroadEn_05702 pDONR223 100% 83.6% 84.1% None (many diffs) n/a
5 ccsbBroad304_05702 pLX_304 0% 83.6% 84.1% V5 (many diffs) n/a
6 TRCN0000472638 CATTTTGTAGGCCCATAGTGCACT pLX_317 39.4% 83.6% 84.1% V5 (many diffs) n/a
Download CSV