Transcript: Human NM_001359651.1

Homo sapiens penta-EF-hand domain containing 1 (PEF1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
PEF1 (553115)
Length:
1838
CDS:
425..1069

Additional Resources:

NCBI RefSeq record:
NM_001359651.1
NBCI Gene record:
PEF1 (553115)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001359651.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000298677 GCAATTGGTCTTCATTCAATG pLKO_005 651 CDS 100% 10.800 8.640 N PEF1 n/a
2 TRCN0000055953 CCTGCATCATAGCCACCAAAT pLKO.1 1221 3UTR 100% 10.800 7.560 N PEF1 n/a
3 TRCN0000286600 CCTGCATCATAGCCACCAAAT pLKO_005 1221 3UTR 100% 10.800 7.560 N PEF1 n/a
4 TRCN0000055956 CAGTGGCTATATCTCCATGAA pLKO.1 604 CDS 100% 4.950 3.465 N PEF1 n/a
5 TRCN0000333631 CAGTGGCTATATCTCCATGAA pLKO_005 604 CDS 100% 4.950 3.465 N PEF1 n/a
6 TRCN0000055955 CCTCATGATGATAAACATGTT pLKO.1 682 CDS 100% 4.950 3.465 N PEF1 n/a
7 TRCN0000286664 CCTCATGATGATAAACATGTT pLKO_005 682 CDS 100% 4.950 3.465 N PEF1 n/a
8 TRCN0000055957 TCTGTCCCAAATGGGCTACAA pLKO.1 841 CDS 100% 4.950 3.465 N PEF1 n/a
9 TRCN0000055954 TGACAGCTTCTCGGATGCTAT pLKO.1 1047 CDS 100% 4.950 3.465 N PEF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001359651.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05702 pDONR223 100% 75.3% 75.3% None 0_1ins210 n/a
2 ccsbBroad304_05702 pLX_304 0% 75.3% 75.3% V5 0_1ins210 n/a
3 TRCN0000472638 CATTTTGTAGGCCCATAGTGCACT pLX_317 39.4% 75.3% 75.3% V5 0_1ins210 n/a
4 ccsbBroadEn_10182 pDONR223 100% 75.1% 75.3% None 0_1ins210;594T>C;627A>G n/a
5 ccsbBroad304_10182 pLX_304 0% 75.1% 75.3% V5 0_1ins210;594T>C;627A>G n/a
6 TRCN0000475874 GATTGGCAGATATTATCGAAGTCG pLX_317 35% 75.1% 75.3% V5 0_1ins210;594T>C;627A>G n/a
Download CSV