Construct: ORF TRCN0000472664
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007461.4_s317c1
- Derived from:
- ccsbBroadEn_14537
- DNA Barcode:
- AGCCTGAGTACTTAGTACGGATTA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- AK4 (205)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472664
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 205 | AK4 | adenylate kinase 4 | NM_001005353.2 | 100% | 100% | |
2 | human | 205 | AK4 | adenylate kinase 4 | NM_013410.4 | 100% | 100% | |
3 | human | 205 | AK4 | adenylate kinase 4 | NM_203464.2 | 100% | 100% | |
4 | human | 205 | AK4 | adenylate kinase 4 | NM_001330616.2 | 76.6% | 76.6% | 0_1ins156 |
5 | human | 205 | AK4 | adenylate kinase 4 | XM_017000613.1 | 76.6% | 76.6% | 0_1ins156 |
6 | mouse | 11639 | Ak4 | adenylate kinase 4 | NM_001177602.1 | 87.7% | 90.1% | (many diffs) |
7 | mouse | 11639 | Ak4 | adenylate kinase 4 | NM_001177604.1 | 87.7% | 90.1% | (many diffs) |
8 | mouse | 11639 | Ak4 | adenylate kinase 4 | NM_001177605.1 | 87.7% | 90.1% | (many diffs) |
9 | mouse | 11639 | Ak4 | adenylate kinase 4 | NM_009647.5 | 87.7% | 90.1% | (many diffs) |
10 | mouse | 11639 | Ak4 | adenylate kinase 4 | XM_017319923.1 | 72.7% | 75.3% | (many diffs) |
11 | mouse | 11639 | Ak4 | adenylate kinase 4 | XM_006502685.3 | 58.2% | 61.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 735
- ORF length:
- 669
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc ttccaaactc ctgcgcgcgg tcatcctcgg gccgcccggc tcgggcaagg 121 gcaccgtgtg ccagaggatc gcccagaact ttggtctcca gcatctctcc agcggccact 181 tcttgcggga gaacatcaag gccagcaccg aagttggtga gatggcaaag cagtatatag 241 agaaaagtct tttggttcca gaccatgtga tcacacgcct aatgatgtcc gagttggaga 301 acaggcgtgg ccagcactgg ctccttgatg gttttcctag gacattagga caagccgaag 361 ccctggacaa aatctgtgaa gtggatctag tgatcagttt gaatattcca tttgaaacac 421 ttaaagatcg tcTCAGCCGC CGTTGGATTC ACCCTCCTAG CGGAAGGGTA TATAACCTGG 481 ACTTCAATCC ACCTCATGTA CATGGTATTG ATGACGTCAC TGGTGAACCG TTAGTCCAGC 541 AGGAGGATGA TAAACCCGAA GCAGTTGCTG CCAGGCTAAG ACAGTACAAA GACGTGGCAA 601 AGCCAGTCAT TGAATTATAC AAGAGCCGAG GAGTGCTCCA CCAATTTTCC GGAACGGAGA 661 CGAACAAAAT CTGGCCCTAC GTTTACACAC TTTTCTCAAA CAAGATCACA CCTATTCAGT 721 CCAAAGAAGC ATATTGCCCA ACTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 781 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 841 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA AGCCTGAGTA CTTAGTACGG 901 ATTAACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt