Transcript: Mouse NM_001177602.1

Mus musculus adenylate kinase 4 (Ak4), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Ak4 (11639)
Length:
5136
CDS:
361..1032

Additional Resources:

NCBI RefSeq record:
NM_001177602.1
NBCI Gene record:
Ak4 (11639)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001177602.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000353108 TCTAGCGGGAGGGTCTATAAC pLKO_005 751 CDS 100% 13.200 18.480 N Ak4 n/a
2 TRCN0000345105 TCACGTGATCACACGCCTAAT pLKO_005 558 CDS 100% 10.800 15.120 N Ak4 n/a
3 TRCN0000025523 ACACCTATTCAATCCAAAGAA pLKO.1 1003 CDS 100% 5.625 7.875 N Ak4 n/a
4 TRCN0000345031 ACACCTATTCAATCCAAAGAA pLKO_005 1003 CDS 100% 5.625 7.875 N Ak4 n/a
5 TRCN0000024679 GACCTAGTAATCAGTTTGAAT pLKO.1 679 CDS 100% 5.625 7.875 N Gm1890 n/a
6 TRCN0000024682 CGAAAGGATCGCCCAGAACTT pLKO.1 426 CDS 100% 4.950 3.960 N Gm1890 n/a
7 TRCN0000345104 CCCTTCACAGGAACGAGTATA pLKO_005 1247 3UTR 100% 13.200 9.240 N Ak4 n/a
8 TRCN0000345103 CTGTGATGTGGACCTAGTAAT pLKO_005 669 CDS 100% 13.200 9.240 N Ak4 n/a
9 TRCN0000025522 ACACGCCTAATGATGTCAGAA pLKO.1 568 CDS 100% 4.950 3.465 N Ak4 n/a
10 TRCN0000025519 GCACTGGCTGTTAGATGGATT pLKO.1 609 CDS 100% 4.950 3.465 N Ak4 n/a
11 TRCN0000024680 CAGGAAGATGATAAACCTGAA pLKO.1 835 CDS 100% 4.050 2.835 N Gm1890 n/a
12 TRCN0000024683 AGACACTTAAAGATCGTCTGA pLKO.1 710 CDS 100% 2.640 1.848 N Gm1890 n/a
13 TRCN0000025520 CGGAAGTTGGTGACGTGGCAA pLKO.1 503 CDS 100% 0.880 0.616 N Ak4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001177602.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00045 pDONR223 100% 87.7% 90.1% None (many diffs) n/a
2 ccsbBroad304_00045 pLX_304 0% 87.7% 90.1% V5 (many diffs) n/a
3 TRCN0000469806 AGTAAGTGTGAGCCGGGCCCGCTC pLX_317 71.4% 87.7% 90.1% V5 (many diffs) n/a
4 ccsbBroadEn_14537 pDONR223 0% 87.7% 90.1% None (many diffs) n/a
5 ccsbBroad304_14537 pLX_304 0% 87.7% 90.1% V5 (many diffs) n/a
6 TRCN0000472664 AGCCTGAGTACTTAGTACGGATTA pLX_317 45.4% 87.7% 90.1% V5 (many diffs) n/a
7 TRCN0000488411 TTTGTTGTGGCTTAATTGTGCCGC pLX_317 45.2% 87.7% 90.1% V5 (not translated due to prior stop codon) (many diffs) n/a
8 TRCN0000488457 TGCCTCAGGCCCAATTCCCCTACA pLX_317 45.2% 87.7% 90.1% V5 (not translated due to prior stop codon) (many diffs) n/a
9 ccsbBroadEn_05797 pDONR223 100% 87.5% 90.1% None (many diffs) n/a
10 ccsbBroad304_05797 pLX_304 0% 87.5% 90.1% V5 (many diffs) n/a
11 TRCN0000474202 TGTGCGCACATTTCCTGATTCGTT pLX_317 37.4% 87.5% 90.1% V5 (many diffs) n/a
12 ccsbBroadEn_15352 pDONR223 0% 87.5% 89.6% None (many diffs) n/a
13 ccsbBroad304_15352 pLX_304 0% 87.5% 89.6% V5 (many diffs) n/a
14 TRCN0000467157 AATCGTATCATCACATTTATCATT pLX_317 45.4% 87.4% 88.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV