Transcript: Human NM_001330616.2

Homo sapiens adenylate kinase 4 (AK4), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
AK4 (205)
Length:
6642
CDS:
159..674

Additional Resources:

NCBI RefSeq record:
NM_001330616.2
NBCI Gene record:
AK4 (205)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001148207 TCCGAGTTGGAGAACAGGCG pXPR_003 TGG 83 16% 2 -0.2029 AK4 AK4 77693
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001330616.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000199843 CGAGGAGTGCTCCACCAATTT pLKO.1 564 CDS 100% 13.200 18.480 N AK4 n/a
2 TRCN0000199236 CGCCTAATGATGTCCGAGTTG pLKO.1 213 CDS 100% 4.050 5.670 N AK4 n/a
3 TRCN0000196859 GAAACACTTAAAGATCGTCTC pLKO.1 351 CDS 100% 2.250 3.150 N AK4 n/a
4 TRCN0000037557 CCATGTGATCACACGCCTAAT pLKO.1 200 CDS 100% 10.800 8.640 N AK4 n/a
5 TRCN0000037555 GCCAGTCATTGAATTATACAA pLKO.1 539 CDS 100% 5.625 4.500 N AK4 n/a
6 TRCN0000078639 GACTTCAATCCACCTCATGTA pLKO.1 417 CDS 100% 4.950 3.960 N AK4 n/a
7 TRCN0000082386 GCCGTTGGATTCACCCTCCTA pLKO.1 376 CDS 100% 0.880 0.704 N LOC441047 n/a
8 TRCN0000078640 CAAAGCCAGTCATTGAATTAT pLKO.1 535 CDS 100% 15.000 10.500 N AK4 n/a
9 TRCN0000196881 GCATGGGAAGTTAAGTATTTA pLKO.1 1576 3UTR 100% 15.000 10.500 N AK4 n/a
10 TRCN0000196406 GCTGTTGCTGTGGTAATATTT pLKO.1 982 3UTR 100% 15.000 10.500 N AK4 n/a
11 TRCN0000218924 GGCTACCTTAGTGGAAATATA pLKO_005 2371 3UTR 100% 15.000 10.500 N AK4P3 n/a
12 TRCN0000218925 TGAATCGTCAGTGCATTATAT pLKO_005 2478 3UTR 100% 15.000 10.500 N AK4P3 n/a
13 TRCN0000078638 CCTCCTGGTAACAGTGAAATT pLKO.1 1135 3UTR 100% 13.200 9.240 N AK4 n/a
14 TRCN0000257440 TCTGAGCACTTTAGAATTTAG pLKO_005 2503 3UTR 100% 13.200 9.240 N AK4P3 n/a
15 TRCN0000037556 CCACCTCATGTACATGGTATT pLKO.1 426 CDS 100% 10.800 7.560 N AK4 n/a
16 TRCN0000037554 GCCAGGCTAAGACAGTACAAA pLKO.1 507 CDS 100% 5.625 3.938 N AK4 n/a
17 TRCN0000078641 CTCAAACAAGATCACACCTAT pLKO.1 632 CDS 100% 4.950 3.465 N AK4 n/a
18 TRCN0000037558 GCAAAGCAGTATATAGAGAAA pLKO.1 162 CDS 100% 4.950 3.465 N AK4 n/a
19 TRCN0000078642 CTGGACTTCAATCCACCTCAT pLKO.1 414 CDS 100% 4.050 2.835 N AK4 n/a
20 TRCN0000199690 CCGTTGGATTCACCCTCCTAG pLKO.1 377 CDS 100% 1.350 0.945 N AK4 n/a
21 TRCN0000230957 CCAGTGAATCCTCTGTCAATT pLKO_005 2245 3UTR 100% 13.200 7.920 N AK4P3 n/a
22 TRCN0000230958 TAGGAAATGTAGAGAGTTATT pLKO_005 2682 3UTR 100% 13.200 7.920 N AK4P3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001330616.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05797 pDONR223 100% 76.6% 76.6% None 0_1ins156 n/a
2 ccsbBroad304_05797 pLX_304 0% 76.6% 76.6% V5 0_1ins156 n/a
3 TRCN0000474202 TGTGCGCACATTTCCTGATTCGTT pLX_317 37.4% 76.6% 76.6% V5 0_1ins156 n/a
4 ccsbBroadEn_00045 pDONR223 100% 76.6% 76.6% None 0_1ins156 n/a
5 ccsbBroad304_00045 pLX_304 0% 76.6% 76.6% V5 0_1ins156 n/a
6 TRCN0000469806 AGTAAGTGTGAGCCGGGCCCGCTC pLX_317 71.4% 76.6% 76.6% V5 0_1ins156 n/a
7 ccsbBroadEn_14537 pDONR223 0% 76.6% 76.6% None 0_1ins156 n/a
8 ccsbBroad304_14537 pLX_304 0% 76.6% 76.6% V5 0_1ins156 n/a
9 TRCN0000472664 AGCCTGAGTACTTAGTACGGATTA pLX_317 45.4% 76.6% 76.6% V5 0_1ins156 n/a
10 ccsbBroadEn_15352 pDONR223 0% 76.6% 76.6% None 0_1ins156 n/a
11 ccsbBroad304_15352 pLX_304 0% 76.6% 76.6% V5 0_1ins156 n/a
12 TRCN0000467157 AATCGTATCATCACATTTATCATT pLX_317 45.4% 76.5% 75.3% V5 (not translated due to prior stop codon) 0_1ins156;505G>T n/a
13 TRCN0000488411 TTTGTTGTGGCTTAATTGTGCCGC pLX_317 45.2% 76.6% 76.6% V5 (not translated due to prior stop codon) 0_1ins156 n/a
14 TRCN0000488457 TGCCTCAGGCCCAATTCCCCTACA pLX_317 45.2% 76.6% 76.6% V5 (not translated due to prior stop codon) 0_1ins156 n/a
15 ccsbBroadEn_15335 pDONR223 100% 40.3% 37% None (many diffs) n/a
16 ccsbBroad304_15335 pLX_304 0% 40.3% 37% V5 (many diffs) n/a
17 TRCN0000466441 TACTAAGGAGAGATAGGTAGTATC pLX_317 92.6% 40.3% 37% V5 (many diffs) n/a
Download CSV