Construct: ORF TRCN0000472692
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF001483.1_s317c1
- Derived from:
- ccsbBroadEn_13924
- DNA Barcode:
- CGACGGTTTGATCTCGCACGTGCG
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Early stop codon detected
Originally Annotated References:
- Gene:
- PPP2CA (5515)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472692
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5515 | PPP2CA | protein phosphatase 2 catal... | NM_002715.4 | 99.8% | 1.6% | 12delG |
| 2 | human | 5515 | PPP2CA | protein phosphatase 2 catal... | NM_001355019.1 | 79% | 2.4% | 0_1ins194 |
| 3 | human | 5515 | PPP2CA | protein phosphatase 2 catal... | NR_149151.1 | 33.2% | (many diffs) | |
| 4 | mouse | 19052 | Ppp2ca | protein phosphatase 2 (form... | NM_019411.4 | 94.2% | 1.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 114
- ORF length:
- 48
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga cgagaagtgt tcaccaagga gctggaccag tggatcgagc agctgaacga 121 gtgcaagcag ctgtccgagt cccaggtcaa gagcctctgc gagaaggcta aagaaatcct 181 gacaaaagaa tccaacgtgc aagaggttcg atgtccagtt actgtctgtg gagatgtgca 241 tgggcaattt catgatctca tggaactgtt tagaattggt ggcaaatcac cagatacaaa 301 ttacttgttt atgggagatt atgttgacag aggatattat tcagttgaaa cagttacact 361 gcttgtagct cttaaggttc gttaccgtga acgcatcacc attcttcgag ggaatcatga 421 gagcagacag atcacacaag tttatggttt ctatgatgaa tgtttaagaa aatatggaaa 481 tgcaaatgtt tggaaatatt ttacagaTCT TTTTGACTAT CTTCCTCTCA CTGCCTTGGT 541 GGATGGGCAG ATCTTCTGTC TACATGGTGG TCTCTCGCCA TCTATAGATA CACTGGATCA 601 TATCAGAGCA CTTGATCGCC TACAAGAAGT TCCCCATGAG GGTCCAATGT GTGACTTGCT 661 GTGGTCAGAT CCAGATGACC GTGGTGGTTG GGGTATATCT CCTCGAGGAG CTGGTTACAC 721 CTTTGGGCAA GATATTTCTG AGACATTTAA TCATGCCAAT GGCCTCACGT TGGTGTCTAG 781 AGCTCACCAG CTAGTGATGG AGGGATATAA CTGGTGCCAT GACCGGAATG TAGTAACGAT 841 TTTCAGTGCT CCAAACTATT GTTATCGTTG TGGTAACCAA GCTGCAATCA TGGAACTTGA 901 CGATACTCTA AAATACTCTT TCTTGCAGTT TGACCCAGCA CCTCGTAGAG GCGAGCCACA 961 TGTTACTCGT CGTACCCCAG ACTACTTCCT GTACCCAACT TTCTTGTACA AAGTGGTTGA 1021 TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG 1081 TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGACGA 1141 CGGTTTGATC TCGCACGTGC GACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt 1201 tgtgaaagat t