Transcript: Mouse NM_019411.4

Mus musculus protein phosphatase 2 (formerly 2A), catalytic subunit, alpha isoform (Ppp2ca), mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Ppp2ca (19052)
Length:
1930
CDS:
226..1155

Additional Resources:

NCBI RefSeq record:
NM_019411.4
NBCI Gene record:
Ppp2ca (19052)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019411.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000081365 CGACGAGTGTTTAAGGAAATA pLKO.1 615 CDS 100% 13.200 10.560 N Ppp2ca n/a
2 TRCN0000332730 CGACGAGTGTTTAAGGAAATA pLKO_005 615 CDS 100% 13.200 10.560 N Ppp2ca n/a
3 TRCN0000306606 GACCGGAACGTAGTAACAATT pLKO_005 982 CDS 100% 13.200 10.560 N Ppp2ca n/a
4 TRCN0000375568 TTGACGACACTCTTAAGTATT pLKO_005 1058 CDS 100% 13.200 10.560 N Ppp2ca n/a
5 TRCN0000081366 AGAGGATATTACTCTGTTGAA pLKO.1 490 CDS 100% 4.950 3.960 N Ppp2ca n/a
6 TRCN0000311590 GCTGGTGATGGAGGGATATAA pLKO_005 951 CDS 100% 15.000 10.500 N Ppp2ca n/a
7 TRCN0000081363 GCGACATTGTTGGTCAAGAAT pLKO.1 1367 3UTR 100% 5.625 3.938 N Ppp2ca n/a
8 TRCN0000363550 GCGACATTGTTGGTCAAGAAT pLKO_005 1367 3UTR 100% 5.625 3.938 N Ppp2ca n/a
9 TRCN0000081364 CCAGATACAAATTACCTGTTT pLKO.1 451 CDS 100% 4.950 3.465 N Ppp2ca n/a
10 TRCN0000332732 CCAGATACAAATTACCTGTTT pLKO_005 451 CDS 100% 4.950 3.465 N Ppp2ca n/a
11 TRCN0000081367 GAGACATTTAATCATGCCAAT pLKO.1 901 CDS 100% 4.050 2.835 N Ppp2ca n/a
12 TRCN0000002485 GAGGGATATAACTGGTGCCAT pLKO.1 961 CDS 100% 2.640 1.584 N PPP2CA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019411.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13924 pDONR223 100% 94.2% 1.6% None (many diffs) n/a
2 ccsbBroad304_13924 pLX_304 0% 94.2% 1.6% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000472692 CGACGGTTTGATCTCGCACGTGCG pLX_317 52.3% 94.2% 1.6% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000489912 GGACAAGAAATCAACTTGTATCGC pLX_317 40.1% 94.2% 99.6% V5 (many diffs) n/a
5 TRCN0000489841 CCTCCTTCCTTGGGTTCTATCTTC pLX_317 44.8% 93.6% 99.6% V5 (not translated due to prior stop codon) (many diffs) n/a
6 ccsbBroadEn_01262 pDONR223 100% 80.9% 97.4% None (many diffs) n/a
7 ccsbBroad304_01262 pLX_304 0% 80.9% 97.4% V5 (many diffs) n/a
8 TRCN0000472494 TCCGTGTTGCGGATAGAGAATCTT pLX_317 48.3% 80.9% 97.4% V5 (many diffs) n/a
9 TRCN0000488986 AAGAGGAGCAGGTAGGGGCTAGTG pLX_317 32.9% 80.9% 97.4% V5 (many diffs) n/a
10 TRCN0000488598 GTAAACAACTCACACCTAAAGTCC pLX_317 38.4% 80.3% 97.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV