Transcript: Human NM_002715.4

Homo sapiens protein phosphatase 2 catalytic subunit alpha (PPP2CA), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
PPP2CA (5515)
Length:
4582
CDS:
213..1142

Additional Resources:

NCBI RefSeq record:
NM_002715.4
NBCI Gene record:
PPP2CA (5515)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002715.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380015 ACCGGAATGTAGTAACGATTT pLKO_005 970 CDS 100% 10.800 15.120 N PPP2CA n/a
2 TRCN0000315048 GCTAGTGATGGAGGGATATAA pLKO_005 938 CDS 100% 15.000 10.500 N PPP2CA n/a
3 TRCN0000002486 CCCATGTTGTTCTTTGTTATT pLKO.1 1687 3UTR 100% 13.200 9.240 N PPP2CA n/a
4 TRCN0000315047 CCCATGTTGTTCTTTGTTATT pLKO_005 1687 3UTR 100% 13.200 9.240 N PPP2CA n/a
5 TRCN0000380685 GGCAAATCACCAGATACAAAT pLKO_005 429 CDS 100% 13.200 9.240 N PPP2CA n/a
6 TRCN0000002484 CACACAAGTTTATGGTTTCTA pLKO.1 581 CDS 100% 5.625 3.938 N PPP2CA n/a
7 TRCN0000315046 CACACAAGTTTATGGTTTCTA pLKO_005 581 CDS 100% 5.625 3.938 N PPP2CA n/a
8 TRCN0000002483 TGGAACTTGACGATACTCTAA pLKO.1 1039 CDS 100% 4.950 3.465 N PPP2CA n/a
9 TRCN0000315115 TGGAACTTGACGATACTCTAA pLKO_005 1039 CDS 100% 4.950 3.465 N PPP2CA n/a
10 TRCN0000081367 GAGACATTTAATCATGCCAAT pLKO.1 888 CDS 100% 4.050 2.835 N Ppp2ca n/a
11 TRCN0000002482 ACTATTGTTATCGTTGTGGTA pLKO.1 1003 CDS 100% 2.640 1.848 N PPP2CA n/a
12 TRCN0000002485 GAGGGATATAACTGGTGCCAT pLKO.1 948 CDS 100% 2.640 1.848 N PPP2CA n/a
13 TRCN0000081363 GCGACATTGTTGGTCAAGAAT pLKO.1 1356 3UTR 100% 5.625 3.938 N Ppp2ca n/a
14 TRCN0000363550 GCGACATTGTTGGTCAAGAAT pLKO_005 1356 3UTR 100% 5.625 3.938 N Ppp2ca n/a
15 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3387 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002715.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489912 GGACAAGAAATCAACTTGTATCGC pLX_317 40.1% 100% 100% V5 n/a
2 ccsbBroadEn_13924 pDONR223 100% 99.8% 1.6% None 12delG n/a
3 ccsbBroad304_13924 pLX_304 0% 99.8% 1.6% V5 (not translated due to prior stop codon) 12delG n/a
4 TRCN0000472692 CGACGGTTTGATCTCGCACGTGCG pLX_317 52.3% 99.8% 1.6% V5 (not translated due to prior stop codon) 12delG n/a
5 TRCN0000489841 CCTCCTTCCTTGGGTTCTATCTTC pLX_317 44.8% 99.3% 100% V5 (not translated due to prior stop codon) 927_928insTAAGCT n/a
6 ccsbBroadEn_01262 pDONR223 100% 83.1% 97.4% None (many diffs) n/a
7 ccsbBroad304_01262 pLX_304 0% 83.1% 97.4% V5 (many diffs) n/a
8 TRCN0000472494 TCCGTGTTGCGGATAGAGAATCTT pLX_317 48.3% 83.1% 97.4% V5 (many diffs) n/a
9 TRCN0000488986 AAGAGGAGCAGGTAGGGGCTAGTG pLX_317 32.9% 83.1% 97.4% V5 (many diffs) n/a
10 TRCN0000488598 GTAAACAACTCACACCTAAAGTCC pLX_317 38.4% 82.6% 97.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV