Construct: ORF TRCN0000472754
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF010659.1_s317c1
- Derived from:
- ccsbBroadEn_13453
- DNA Barcode:
- TGAAGACCTGGACACGGGATGATG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CERS6 (253782)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472754
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 253782 | CERS6 | ceramide synthase 6 | NM_001256126.2 | 100% | 100% | |
| 2 | human | 253782 | CERS6 | ceramide synthase 6 | NM_203463.3 | 97.9% | 97.9% | 1002_1003ins24 |
| 3 | human | 253782 | CERS6 | ceramide synthase 6 | XM_024452780.1 | 72.9% | 71.9% | (many diffs) |
| 4 | human | 253782 | CERS6 | ceramide synthase 6 | XM_024452781.1 | 71.6% | 71.6% | 843_844ins333 |
| 5 | human | 253782 | CERS6 | ceramide synthase 6 | XM_017003749.2 | 63.1% | 61.3% | (many diffs) |
| 6 | human | 253782 | CERS6 | ceramide synthase 6 | XM_005246440.5 | 51% | 51% | 0_1ins576 |
| 7 | mouse | 241447 | Cers6 | ceramide synthase 6 | NM_001347161.1 | 90.4% | 95.4% | (many diffs) |
| 8 | mouse | 241447 | Cers6 | ceramide synthase 6 | NM_172856.4 | 88.5% | 93.3% | (many diffs) |
| 9 | mouse | 241447 | Cers6 | ceramide synthase 6 | XM_017318074.1 | 59.7% | 61.9% | (many diffs) |
| 10 | mouse | 241447 | Cers6 | ceramide synthase 6 | XR_374464.3 | 14.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1245
- ORF length:
- 1176
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggcagggatc ttagcctggt tctggaacga gaggttttgg ctcccgcaca 121 atgtcacctg ggcggacctg aagaacacgg aggaggccac cttcccgcag gctgaggacc 181 tctatctcgc ttttcccctg gccttctgta tcttcatggt gcggctcatc ttcgagagat 241 ttgtagccaa accgtgcgcc atagccctca acattcaggc caatggacca caaattgctc 301 cgcccaatgc cattctggaa aaggtcttca ctgcaattac aaagcatcct gatgaaaaga 361 gattggaagg cctctccaag caactggact gggatgttcg aagcattcag cgctggtttc 421 gacaaagacg caatcaggag aagccaagca cgctgacgag gttctgtgag agcatgtgga 481 gattttcatt ttacctttat gtatttacct acggagtcag attcctgaaa aagaccccct 541 ggttgtggaa tacgaggcat tgctggtaca actaccccta tcagccactc acaactgacc 601 ttcactacta ttacatcctg gagctgtcgt tttattggtc tttgatgttt tctcagttca 661 ctgatatcaa aagaaaggac tttggcatta tgttcctgca ccaccttgta tctattttct 721 tgattacctt ttcatatgtc aacaatatgg cccgagtagg aacgctggtc ctttgtcttc 781 atgattcagc tgatgctcTT CTGGAGGCTG CCAAAATGGC AAATTATGCC AAGTTTCAGA 841 AAATGTGTGA TCTCCTGTTT GTTATGTTTG CCGTGGTTTT TATCACCACA CGACTGGGTA 901 TATTTCCTCT CTGGGTGTTA AATACCACAT TATTTGAAAG CTGGGAGATC GTTGGACCTT 961 ACCCTTCCTG GTGGGTTTTT AACCTACTGC TATTGCTAGT ACAAGGGTTG AACTGCTTCT 1021 GGTCTTACTT GATTGTGAAA ATAGCTTGCA AAGCTGTTTC AAGAGGCAAG GCTGGGAAGT 1081 GGAACCCTTT ACATGTGTCC AAGGATGATC GAAGTGATAT TGAGTCTAGC TCAGATGAGG 1141 AGGACTCAGA ACCTCCGGGA AAGAATCCCC ACACTGCGAC AACCACCAAT GGGACCAGTG 1201 GTACCAACGG GTATCTCCTG ACTGGCTCCT GCTCCATGGA TGATTTGCCA ACTTTCTTGT 1261 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 1321 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 1381 GAAAGGACGA TGAAGACCTG GACACGGGAT GATGACGCGT TAAGTCgaca atcaacctct 1441 ggattacaaa atttgtgaaa gatt