Transcript: Mouse NM_001347161.1

Mus musculus ceramide synthase 6 (Cers6), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Cers6 (241447)
Length:
7063
CDS:
196..1374

Additional Resources:

NCBI RefSeq record:
NM_001347161.1
NBCI Gene record:
Cers6 (241447)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001347161.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428797 TCAACGCTGGTTTCGACAAAG pLKO_005 534 CDS 100% 10.800 15.120 N Cers6 n/a
2 TRCN0000086351 CTGCTGGTATAACTACCCTTA pLKO.1 687 CDS 100% 4.050 5.670 N Cers6 n/a
3 TRCN0000086349 GCTATAACAAAGCATCCTGAT pLKO.1 460 CDS 100% 4.050 5.670 N Cers6 n/a
4 TRCN0000431823 ACCACACGGCTGGGCATATTT pLKO_005 1012 CDS 100% 15.000 12.000 N Cers6 n/a
5 TRCN0000086348 CGTGAGTCAAACATCTCCTAA pLKO.1 2782 3UTR 100% 4.950 3.960 N Cers6 n/a
6 TRCN0000436656 AGCTGACCTTCACTACTATTA pLKO_005 720 CDS 100% 13.200 9.240 N Cers6 n/a
7 TRCN0000416404 CTGCACCACCTTGCAACAATT pLKO_005 823 CDS 100% 13.200 9.240 N Cers6 n/a
8 TRCN0000432431 CATTCTCTGGGCTCGTGATTG pLKO_005 1677 3UTR 100% 10.800 7.560 N Cers6 n/a
9 TRCN0000086352 CTTGTTACTACAAGGGTTGAA pLKO.1 1119 CDS 100% 0.495 0.347 N Cers6 n/a
10 TRCN0000086350 GCTCTTGTTACTACAAGGGTT pLKO.1 1116 CDS 100% 0.264 0.185 N Cers6 n/a
11 TRCN0000344343 CGGCTCATCTTCGAGAGATTT pLKO_005 349 CDS 100% 13.200 10.560 N CERS6 n/a
12 TRCN0000128836 GAACTGCTTCTGGTCTTACTT pLKO.1 1137 CDS 100% 5.625 4.500 N CERS6 n/a
13 TRCN0000344342 GAACTGCTTCTGGTCTTACTT pLKO_005 1137 CDS 100% 5.625 4.500 N CERS6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001347161.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13453 pDONR223 100% 90.4% 95.4% None (many diffs) n/a
2 ccsbBroad304_13453 pLX_304 0% 90.4% 95.4% V5 (many diffs) n/a
3 TRCN0000472754 TGAAGACCTGGACACGGGATGATG pLX_317 38.1% 90.4% 95.4% V5 (many diffs) n/a
Download CSV