Construct: ORF TRCN0000472765
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004301.1_s317c1
- Derived from:
- ccsbBroadEn_13980
- DNA Barcode:
- AGGGTTTGTAGTCCAAACGGGTGA
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Early stop codon detected
Originally Annotated References:
- Gene:
- VASP (7408)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472765
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 7408 | VASP | vasodilator stimulated phos... | NM_003370.4 | 99.9% | 1.5% | 12delG |
| 2 | human | 7408 | VASP | vasodilator stimulated phos... | XM_005259199.2 | 99.6% | 1.5% | 12delG;718_719insAGC |
| 3 | human | 7408 | VASP | vasodilator stimulated phos... | XM_005259200.2 | 99.6% | 1.5% | 12delG;873_874insCAG |
| 4 | human | 7408 | VASP | vasodilator stimulated phos... | XM_017027200.2 | 99.3% | 1.5% | 12delG;718_719insAGC;870_871insCAG |
| 5 | mouse | 22323 | Vasp | vasodilator-stimulated phos... | NM_009499.3 | 86.2% | 1% | (many diffs) |
| 6 | mouse | 22323 | Vasp | vasodilator-stimulated phos... | NM_001282021.1 | 85.9% | 1% | (many diffs) |
| 7 | mouse | 22323 | Vasp | vasodilator-stimulated phos... | NM_001282022.1 | 83.9% | 1% | (many diffs) |
| 8 | mouse | 22323 | Vasp | vasodilator-stimulated phos... | NR_104069.1 | 26.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 102
- ORF length:
- 36
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgag cgagacgtca tctgttccag ccgggccact gtgatgcttt atgatgatgg 121 caacaagcga tggctccctg ctggcacggg tccccaggcc ttcagccgcg tccagatcta 181 ccacaacccc acggccaatt cctttcgcgt cgtgggccgg aagatgcagc ccgaccagca 241 ggtggtcatc aactgtgcca tcgtccgggg tgtcaagtat aaccaggcca cccccaactt 301 ccatcagtgg cgcgacgctc gccaggtctg gggcctcaac ttcggcagca aggaggatgc 361 ggcccagttt gccgccggca tggccagtgc cctagaggcg ttggaaggag gtgggccccc 421 tccaccccca gcacttccca cctggtcggt cccgaacggc ccctccccgg aggaggtgga 481 gcagcagaaa aggcagcagc ccggcccgtc ggagcacata gagcgccggg tctccaatgc 541 aggaggccca cctgctcccc ccgctggggg tccaccccca ccaccaggac ctccccctcc 601 tccaggtccc cccccacccc caggtttgcc cccttcgggg gtcccagctg cagcgcacgg 661 agcaggggga ggaccacccc ctgcaccccc tctcccggca gcacagggcc ctggtggtgg 721 gggagctggg gccccaggcc tggccgcagc tattgctgga gccaaactca ggaaagtcag 781 caagcaggag gaggcctcag gggggcccac agcccccaaa gctgagagtg gtcgaagcgg 841 aggtggggga ctcatggaag agatgaacgc catgctggcc cggagaagga aagccacgca 901 agttggggag aaaaccccca aggatgaatc tgccaatcag gaggagccag aggccagagt 961 cccggcccag agtgaatctg tgcggagacc ctgggagaag aacagcacaa ccttgccaag 1021 gatgaagtcg tcttcttcgg tgaccacttc cgagacccaa ccctgcacgc ccagctccag 1081 tgattactcg gacctacaga gggtgaaaca ggagcttctg gAAGAGGTGA AGAAGGAATT 1141 GCAGAAAGTG AAAGAGGAAA TCATTGAAGC CTTCGTCCAG GAGCTGAGGA AGCGGGGTTC 1201 TCCCTGCCCA ACTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT 1261 CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC 1321 TTGGCTTTAT ATATCTTGTG GAAAGGACGA AGGGTTTGTA GTCCAAACGG GTGAACGCGT 1381 TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt