Transcript: Human XM_017027200.2

PREDICTED: Homo sapiens vasodilator stimulated phosphoprotein (VASP), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
VASP (7408)
Length:
2262
CDS:
314..1450

Additional Resources:

NCBI RefSeq record:
XM_017027200.2
NBCI Gene record:
VASP (7408)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017027200.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000117149 CATGGAAGAGATGAACGCCAT pLKO.1 1099 CDS 100% 2.160 1.728 N VASP n/a
2 TRCN0000333196 CATGGAAGAGATGAACGCCAT pLKO_005 1099 CDS 100% 2.160 1.728 N VASP n/a
3 TRCN0000117151 GTGTCAAGTATAACCAGGCCA pLKO.1 519 CDS 100% 0.660 0.528 N VASP n/a
4 TRCN0000369619 CGGGCCACTGTGATGCTTTAT pLKO_005 341 CDS 100% 13.200 9.240 N VASP n/a
5 TRCN0000369620 AGGAATTGCAGAAAGTGAAAG pLKO_005 1377 CDS 100% 10.800 7.560 N VASP n/a
6 TRCN0000117148 CCAAGGATGAAGTCGTCTTCT pLKO.1 1259 CDS 100% 4.950 3.465 N VASP n/a
7 TRCN0000363676 CCAAGGATGAAGTCGTCTTCT pLKO_005 1259 CDS 100% 4.950 3.465 N VASP n/a
8 TRCN0000117147 CCCTTGTTCTAGATTCACTTT pLKO.1 1770 3UTR 100% 4.950 3.465 N VASP n/a
9 TRCN0000333198 CCCTTGTTCTAGATTCACTTT pLKO_005 1770 3UTR 100% 4.950 3.465 N VASP n/a
10 TRCN0000117150 TCCAGTGATTACTCGGACCTA pLKO.1 1319 CDS 100% 2.640 1.848 N VASP n/a
11 TRCN0000333197 TCCAGTGATTACTCGGACCTA pLKO_005 1319 CDS 100% 2.640 1.848 N VASP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017027200.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11215 pDONR223 100% 99.4% 99.2% None 3_4insAGC;870_871insCAG n/a
2 ccsbBroad304_11215 pLX_304 0% 99.4% 99.2% V5 3_4insAGC;870_871insCAG n/a
3 TRCN0000473358 GACTAAATGTCATTATTAATAAAT pLX_317 36.1% 99.4% 99.2% V5 3_4insAGC;870_871insCAG n/a
4 ccsbBroadEn_13980 pDONR223 100% 99.3% 1.5% None 12delG;718_719insAGC;870_871insCAG n/a
5 ccsbBroad304_13980 pLX_304 0% 99.3% 1.5% V5 (not translated due to prior stop codon) 12delG;718_719insAGC;870_871insCAG n/a
6 TRCN0000472765 AGGGTTTGTAGTCCAAACGGGTGA pLX_317 8.1% 99.3% 1.5% V5 (not translated due to prior stop codon) 12delG;718_719insAGC;870_871insCAG n/a
Download CSV