Construct: ORF TRCN0000472767
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF015795.1_s317c1
- Derived from:
- ccsbBroadEn_03890
- DNA Barcode:
- TCTGGTAAAGCGACCGTATGACAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- NIF3L1 (60491)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472767
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 60491 | NIF3L1 | NGG1 interacting factor 3 l... | NM_001136039.2 | 100% | 100% | |
2 | human | 60491 | NIF3L1 | NGG1 interacting factor 3 l... | NM_001369441.1 | 100% | 100% | |
3 | human | 60491 | NIF3L1 | NGG1 interacting factor 3 l... | NM_001369442.1 | 100% | 100% | |
4 | human | 60491 | NIF3L1 | NGG1 interacting factor 3 l... | NM_001369444.1 | 100% | 100% | |
5 | human | 60491 | NIF3L1 | NGG1 interacting factor 3 l... | NM_001369445.2 | 100% | 100% | |
6 | human | 60491 | NIF3L1 | NGG1 interacting factor 3 l... | NM_001142355.1 | 92.8% | 92.8% | 0_1ins81 |
7 | human | 60491 | NIF3L1 | NGG1 interacting factor 3 l... | NM_001369443.1 | 92.8% | 92.8% | 0_1ins81 |
8 | human | 60491 | NIF3L1 | NGG1 interacting factor 3 l... | NM_021824.3 | 92.8% | 92.8% | 0_1ins81 |
9 | human | 60491 | NIF3L1 | NGG1 interacting factor 3 l... | NM_001142356.1 | 75.5% | 66.4% | 724_725ins139;855_856ins137 |
10 | mouse | 65102 | Nif3l1 | Ngg1 interacting factor 3-l... | NM_022988.3 | 84.2% | 84.3% | (many diffs) |
11 | mouse | 65102 | Nif3l1 | Ngg1 interacting factor 3-l... | XM_006496186.1 | 84.2% | 84.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1197
- ORF length:
- 1131
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtt gtcatcttgc gtacgcccag tccccacgac agtccggttt gtagattccc 121 tgatctgcaa ttcttcccgt tccttcatgg atttgaaggc tctcctttct tccttgaatg 181 actttgcatc cctctcgttt gctgagagtt gggacaatgt tggattactg gtggaaccaa 241 gcccaccaca tactgtaaat acactcttcc tgaccaatga cctgactgag gaagtgatgg 301 aggaggtgct gcaaaagaag gcagacctca ttctctccta ccatccgcct atcttccgac 361 ccatgaagcg cataacctgg aacacatgga aggagcgcct ggtgatccgg gctctggaga 421 acagagtcgg tatctactct cctcatacag cctatgatgc tgcgccccag ggcgtcaaca 481 actggttggc taaagggctt ggagcttgta cctccaggcc catacatcct tccaaagctc 541 ccaactaccc tacagaggga aaccaccgag tagaattcaa cgttaactac acccaagacc 601 tggacaaagt catgtctgca gtgaaaggaa ttgacggtgt ttctgtcact tctttttctg 661 ctaggactgg taatgaggaa caaacacgga ttaatctgaa ttgtactcag aaggctttga 721 tgcaggtggt agattttctt tcccggaaca aacaacttta tcagaagacg gaaattctgt 781 cactggagaa gcctttgctt ctacatactg gaatgggacg gttatgcaca ctggatgaat 841 ctgtctccct ggcaaccatg attgatcgaa taaaaagaca cctaaaacta tctcatattc 901 gcttagccct tggggtgggg agaaccttag agtctcaagt caaagtcgtg gccctgtgtg 961 ctggttctgg gagcagcgtt ctgcagggtg ttgaggctga cctttacctc acaggtgaga 1021 tgtcccatca tgatactttg gatgctgctt cccaaggaat aaatgtcatc ctctgtgaac 1081 acagcaacac tgaacgaggc tttctttctg accttCGAGA TATGCTGGAT TCTCACTTGG 1141 AGAATAAGAT AAATATTATC CTATCAGAGA CTGACAGGGA CCCTCTTCAG GTGGTATACC 1201 CAACTTTCTT GTACAAAGTG GTTGATATCG GTAAGCCTAT CCCTAACCCT CTCCTCGGTC 1261 TCGATTCTAC GTAGTAATGA ACTAGTCCGT AACTTGAAAG TATTTCGATT TCTTGGCTTT 1321 ATATATCTTG TGGAAAGGAC GATCTGGTAA AGCGACCGTA TGACAAACGC GTTAAGTCga 1381 caatcaacct ctggattaca aaatttgtga aagatt