Transcript: Mouse XM_006496186.1

PREDICTED: Mus musculus Ngg1 interacting factor 3-like 1 (S. pombe) (Nif3l1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nif3l1 (65102)
Length:
1412
CDS:
82..1212

Additional Resources:

NCBI RefSeq record:
XM_006496186.1
NBCI Gene record:
Nif3l1 (65102)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006496186.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234051 GACCCTCTCCGTGTGGTTTAA pLKO_005 1192 CDS 100% 13.200 18.480 N Nif3l1 n/a
2 TRCN0000218086 GCAATAATGATAGAGCGAATC pLKO_005 865 CDS 100% 6.000 8.400 N Nif3l1 n/a
3 TRCN0000180193 CAGCCTGAATTGTACTCAGAA pLKO.1 705 CDS 100% 4.950 6.930 N Nif3l1 n/a
4 TRCN0000234049 TCTCCTACCATCCACCTATTT pLKO_005 347 CDS 100% 13.200 10.560 N Nif3l1 n/a
5 TRCN0000183917 CACCTAAAGCTGTCGCATCTT pLKO.1 892 CDS 100% 4.950 3.960 N Nif3l1 n/a
6 TRCN0000234050 CTGCTTCCAAAGGGATCAATG pLKO_005 1058 CDS 100% 10.800 7.560 N Nif3l1 n/a
7 TRCN0000184567 GCTGCTTCCAAAGGGATCAAT pLKO.1 1057 CDS 100% 5.625 3.938 N Nif3l1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006496186.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03890 pDONR223 100% 84.2% 84.3% None (many diffs) n/a
2 ccsbBroad304_03890 pLX_304 0% 84.2% 84.3% V5 (many diffs) n/a
3 TRCN0000472767 TCTGGTAAAGCGACCGTATGACAA pLX_317 7.9% 84.2% 84.3% V5 (many diffs) n/a
Download CSV