Transcript: Human NM_001369442.1

Homo sapiens NGG1 interacting factor 3 like 1 (NIF3L1), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
NIF3L1 (60491)
Length:
2615
CDS:
1228..2361

Additional Resources:

NCBI RefSeq record:
NM_001369442.1
NBCI Gene record:
NIF3L1 (60491)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001369442.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000129337 CGTTAACTACACCCAAGACCT pLKO.1 1743 CDS 100% 2.640 3.696 N NIF3L1 n/a
2 TRCN0000280977 CGTTAACTACACCCAAGACCT pLKO_005 1743 CDS 100% 2.640 3.696 N NIF3L1 n/a
3 TRCN0000129413 GCTGAGAGTTGGGACAATGTT pLKO.1 1363 CDS 100% 5.625 3.938 N NIF3L1 n/a
4 TRCN0000297923 GCTGAGAGTTGGGACAATGTT pLKO_005 1363 CDS 100% 5.625 3.938 N NIF3L1 n/a
5 TRCN0000129602 CCTTTACCTCACAGGTGAGAT pLKO.1 2163 CDS 100% 4.950 3.465 N NIF3L1 n/a
6 TRCN0000281048 CCTTTACCTCACAGGTGAGAT pLKO_005 2163 CDS 100% 4.950 3.465 N NIF3L1 n/a
7 TRCN0000130375 GTGAAAGGAATTGACGGTGTT pLKO.1 1783 CDS 100% 4.050 2.835 N NIF3L1 n/a
8 TRCN0000131079 GCTGGATTCTCACTTGGAGAA pLKO.1 2286 CDS 100% 0.405 0.284 N NIF3L1 n/a
9 TRCN0000280979 GCTGGATTCTCACTTGGAGAA pLKO_005 2286 CDS 100% 0.405 0.284 N NIF3L1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001369442.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03890 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03890 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000472767 TCTGGTAAAGCGACCGTATGACAA pLX_317 7.9% 100% 100% V5 n/a
Download CSV