Construct: ORF TRCN0000472789
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF010348.3_s317c1
- Derived from:
- ccsbBroadEn_15123
- DNA Barcode:
- TATCAATTTGCTAGCACAGCTGGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SCYL1 (57410)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472789
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 57410 | SCYL1 | SCY1 like pseudokinase 1 | XM_017018033.1 | 61.3% | 56.9% | (many diffs) |
| 2 | human | 57410 | SCYL1 | SCY1 like pseudokinase 1 | XM_024448620.1 | 60.3% | 56.1% | (many diffs) |
| 3 | human | 57410 | SCYL1 | SCY1 like pseudokinase 1 | XM_005274120.4 | 54.4% | 54.4% | 1_1068del |
| 4 | human | 57410 | SCYL1 | SCY1 like pseudokinase 1 | XM_005274121.4 | 54.2% | 54.2% | 1_1068del;1957_1958insAGC |
| 5 | human | 57410 | SCYL1 | SCY1 like pseudokinase 1 | NM_020680.4 | 52.5% | 49% | 1_1068del;2248_2302del;2399_2424del |
| 6 | human | 57410 | SCYL1 | SCY1 like pseudokinase 1 | XM_005274118.4 | 52.4% | 48.8% | (many diffs) |
| 7 | human | 57410 | SCYL1 | SCY1 like pseudokinase 1 | XM_017018031.2 | 52.2% | 52.2% | 1_1068del;1814_1815ins51 |
| 8 | human | 57410 | SCYL1 | SCY1 like pseudokinase 1 | NM_001048218.2 | 50.4% | 46.9% | (many diffs) |
| 9 | human | 57410 | SCYL1 | SCY1 like pseudokinase 1 | XM_017018030.2 | 50.3% | 46.8% | (many diffs) |
| 10 | human | 57410 | SCYL1 | SCY1 like pseudokinase 1 | XM_024448619.1 | 50.1% | 46.7% | (many diffs) |
| 11 | mouse | 78891 | Scyl1 | SCY1-like 1 (S. cerevisiae) | NM_023912.2 | 44.5% | 43.2% | (many diffs) |
| 12 | mouse | 78891 | Scyl1 | SCY1-like 1 (S. cerevisiae) | XM_006531856.2 | 44.4% | 43% | (many diffs) |
| 13 | mouse | 78891 | Scyl1 | SCY1-like 1 (S. cerevisiae) | XM_006531857.2 | 43.1% | 41.9% | (many diffs) |
| 14 | mouse | 78891 | Scyl1 | SCY1-like 1 (S. cerevisiae) | XR_388273.2 | 22.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1341
- ORF length:
- 1275
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtt ctcatccact gaccgggcca tgcgcatccg cctcctgcag cagatggagc 121 agttcatcca gtaccttgac gagccaacag tcaacaccca gatcttcccc cacgtcgtac 181 atggcttcct ggacaccaac cctgccatcc gggagcagac ggtcaagtcc atgctgctcc 241 tggccccaaa gctgaacgag gccaacctca atgtggagct gatgaagcac tttgcacggc 301 tacaggccaa ggatgaacag ggccccatcc gctgcaacac cacagtctgc ctgggcaaaa 361 tcggctccta cctcagtgct agcaccagac acagggtcct tacctctgcc ttcagccgag 421 ccactaggga cccgtttgca ccgtcccggg ttgcgggtgt cctgggcttt gctgccaccc 481 acaacctcta ctcaatgaac gactgtgccc agaagatcct gcctgtgctc tgcggtctca 541 ctgtagatcc tgagaaatcc gtgcgagacc aggccttcaa ggccattcgg agcttcctgt 601 ccaaattgga gtctgtgtcg gaggacccga cccagctgga ggaagtggag aaggatgtcc 661 atgcagcctc cagccctggc atgggaggag ccgcagctag ctgggcaggc tgggccgtga 721 ccggggtctc ctcactcacc tccaagctga tccgttcgca cccaaccact gccccaacag 781 aaaccaacat tccccaaaga cccacgcctg aaggagttcc tgccccagcc cccacccctg 841 ttcctgccac ccctacaacc tcaggccact gggagacgca ggaggaggac aaggacacag 901 cagaggacag cagcactgct gacagatggg acgacgaaga ctggggcagc cTGGAGCAGG 961 AGGCCGAGTC TGTGCTGGCC CAGCAGGACG ACTGGAGCAC CGGGGGCCAA GTGAGCCGTG 1021 CTAGTCAGGT CAGCAACTCC GACCACAAAT CCTCCAAATC CCCAGAGTCC GACTGGAGCA 1081 GCTGGGAAGC TGAGGGCTCC TGGGAACAGG GCTGGCAGGA GCCAAGCTCC CAGGAGCCAC 1141 CTCCTGACGG TACACGGCTG GCCAGCGAGT ATAACTGGGG TGGCCCAGAG TCCAGCGACA 1201 AGGGCGACCC CTTCGCTACC CTGTCTGCAC GTCCCAGCAC CCAGGACAGG TCAAGGCTGA 1261 GCTGGCCCGG AAGAAGCGCG AGGAGCGGCG GCGGGAGATG GAGGCCAAAC GCGCCGAGAG 1321 GAAGGTGGCC AAGGGCCCCA TGCCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 1381 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 1441 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGATATC AATTTGCTAG 1501 CACAGCTGGC ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt