Transcript: Mouse XR_388273.2

PREDICTED: Mus musculus SCY1-like 1 (S. cerevisiae) (Scyl1), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Scyl1 (78891)
Length:
1785
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_388273.2
NBCI Gene record:
Scyl1 (78891)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_388273.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000027587 CGAAGCTTCCTGTCCAAATTA pLKO.1 1700 3UTR 100% 15.000 21.000 N Scyl1 n/a
2 TRCN0000322273 CGAAGCTTCCTGTCCAAATTA pLKO_005 1700 3UTR 100% 15.000 21.000 N Scyl1 n/a
3 TRCN0000374468 CCCAACATCCTGGCCTATATC pLKO_005 304 3UTR 100% 13.200 18.480 N Scyl1 n/a
4 TRCN0000374467 ATGGACGACTGTGCCCATAAG pLKO_005 1582 3UTR 100% 10.800 8.640 N Scyl1 n/a
5 TRCN0000027607 CCAACAGTCAACACGCAGATT pLKO.1 1231 3UTR 100% 4.950 3.465 N Scyl1 n/a
6 TRCN0000322205 CCAACAGTCAACACGCAGATT pLKO_005 1231 3UTR 100% 4.950 3.465 N Scyl1 n/a
7 TRCN0000027624 CGAAGATTTCTGTCGACACAA pLKO.1 999 3UTR 100% 4.950 3.465 N Scyl1 n/a
8 TRCN0000027636 AGAGCCACTAAGGACCCATTT pLKO.1 1504 3UTR 100% 10.800 6.480 N Scyl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_388273.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12345 pDONR223 100% 22.5% None (many diffs) n/a
2 ccsbBroad304_12345 pLX_304 0% 22.5% V5 (many diffs) n/a
3 TRCN0000471129 ACTTCCTGGATTTAGAACCGTTCA pLX_317 18% 22.5% V5 (many diffs) n/a
4 ccsbBroadEn_15123 pDONR223 0% 22.5% None (many diffs) n/a
5 ccsbBroad304_15123 pLX_304 0% 22.5% V5 (many diffs) n/a
6 TRCN0000472789 TATCAATTTGCTAGCACAGCTGGC pLX_317 30.8% 22.5% V5 (many diffs) n/a
7 TRCN0000488900 TGCGGGCCGGCCCTCCGTCAATTA pLX_317 27.6% 22.5% V5 (not translated due to prior stop codon) (many diffs) n/a
8 TRCN0000491600 GCTGCACTGCGAATTGGCCTGAAT pLX_317 24.1% 22.5% V5 (many diffs) n/a
Download CSV