Transcript: Human XM_017018031.2

PREDICTED: Homo sapiens SCY1 like pseudokinase 1 (SCYL1), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SCYL1 (57410)
Length:
2481
CDS:
34..2328

Additional Resources:

NCBI RefSeq record:
XM_017018031.2
NBCI Gene record:
SCYL1 (57410)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017018031.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000007123 CCCGTTGGGAATATACCTCAA pLKO.1 324 CDS 100% 4.050 5.670 N SCYL1 n/a
2 TRCN0000199956 GCTACACCAGATCGTGAAAGC pLKO.1 393 CDS 100% 4.050 5.670 N SCYL1 n/a
3 TRCN0000342409 GCTACACCAGATCGTGAAAGC pLKO_005 393 CDS 100% 4.050 5.670 N SCYL1 n/a
4 TRCN0000199176 CGCCTTCGAGTTCGGCAATGC pLKO.1 990 CDS 100% 0.000 0.000 N SCYL1 n/a
5 TRCN0000352681 CGCCTTCGAGTTCGGCAATGC pLKO_005 990 CDS 100% 0.000 0.000 N SCYL1 n/a
6 TRCN0000007126 CCCGTGTCCATCTTCGTCTAT pLKO.1 157 CDS 100% 4.950 3.960 N SCYL1 n/a
7 TRCN0000342368 CCCGTGTCCATCTTCGTCTAT pLKO_005 157 CDS 100% 4.950 3.960 N SCYL1 n/a
8 TRCN0000007122 GCTGGACTGAACCGTGGCGGT pLKO.1 2345 3UTR 100% 0.000 0.000 N SCYL1 n/a
9 TRCN0000199039 CGGAGCTTCCTGTCCAAATTG pLKO.1 1624 CDS 100% 13.200 9.240 N SCYL1 n/a
10 TRCN0000007124 CTTTGTAGAAACCAACCTCTT pLKO.1 846 CDS 100% 4.050 2.835 N SCYL1 n/a
11 TRCN0000007125 CCTGTCCAAATTGGAGTCTGT pLKO.1 1632 CDS 100% 2.640 1.848 N SCYL1 n/a
12 TRCN0000199884 GCCCGGAAGCTGGACTGAACC pLKO.1 2337 3UTR 100% 0.000 0.000 N SCYL1 n/a
13 TRCN0000352620 GCCCGGAAGCTGGACTGAACC pLKO_005 2337 3UTR 100% 0.000 0.000 N SCYL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017018031.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12345 pDONR223 100% 52.2% 52.2% None 1_1068del;1814_1815ins51 n/a
2 ccsbBroad304_12345 pLX_304 0% 52.2% 52.2% V5 1_1068del;1814_1815ins51 n/a
3 TRCN0000471129 ACTTCCTGGATTTAGAACCGTTCA pLX_317 18% 52.2% 52.2% V5 1_1068del;1814_1815ins51 n/a
4 ccsbBroadEn_15123 pDONR223 0% 52.2% 52.2% None 1_1068del;1814_1815ins51 n/a
5 ccsbBroad304_15123 pLX_304 0% 52.2% 52.2% V5 1_1068del;1814_1815ins51 n/a
6 TRCN0000472789 TATCAATTTGCTAGCACAGCTGGC pLX_317 30.8% 52.2% 52.2% V5 1_1068del;1814_1815ins51 n/a
7 TRCN0000488900 TGCGGGCCGGCCCTCCGTCAATTA pLX_317 27.6% 52.2% 52.2% V5 (not translated due to prior stop codon) 1_1068del;1814_1815ins51 n/a
8 TRCN0000491600 GCTGCACTGCGAATTGGCCTGAAT pLX_317 24.1% 52.2% 52.1% V5 1_1068del;1814_1815ins51;2292_2293insG n/a
Download CSV