Construct: ORF TRCN0000472807
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004570.1_s317c1
- Derived from:
- ccsbBroadEn_01111
- DNA Barcode:
- CAACAACGACAACAATCGGATGCT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- NTF3 (4908)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472807
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 4908 | NTF3 | neurotrophin 3 | NM_002527.4 | 100% | 100% | |
| 2 | human | 4908 | NTF3 | neurotrophin 3 | XM_011520963.2 | 100% | 100% | |
| 3 | human | 4908 | NTF3 | neurotrophin 3 | NM_001102654.2 | 95.1% | 95.1% | 1_39del |
| 4 | mouse | 18205 | Ntf3 | neurotrophin 3 | NM_008742.3 | 89.2% | 95.7% | (many diffs) |
| 5 | mouse | 18205 | Ntf3 | neurotrophin 3 | XM_006505716.2 | 89.2% | 95.7% | (many diffs) |
| 6 | mouse | 18205 | Ntf3 | neurotrophin 3 | NM_001164034.1 | 84.9% | 91.1% | (many diffs) |
| 7 | mouse | 18205 | Ntf3 | neurotrophin 3 | NM_001164035.1 | 84.9% | 91.1% | (many diffs) |
| 8 | mouse | 18205 | Ntf3 | neurotrophin 3 | XM_006505715.2 | 82.8% | 88.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 837
- ORF length:
- 771
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc catcttgttt tatgtgatat ttctcgctta tctccgtggc atccaaggta 121 acaacatgga tcaaaggagt ttgccagaag actcgctcaa ttccctcatt attaagctga 181 tccaggcaga tattttgaaa aacaagctct ccaagcagat ggtggacgtt aaggaaaatt 241 accagagcac cctgcccaaa gctgaggctc cccgagagcc ggagcgggga gggcccgcca 301 agtcagcatt ccagccggtg attgcaatgg acaccgaact gctgcgacaa cagagacgct 361 acaactcacc gcgggtcctg ctgagcgaca gcaccccctt ggagcccccg cccttgtatc 421 tcatggagga ttacgtgggc agccccgtgg tggcgaacag aacatcacgg cggaaacggt 481 acgcggagca taagagtcac cgaggggagt actcggtatg tgacagtgag agtctgtggg 541 tgaccgacaa gtcatcggcc atcGACATTC GGGGACACCA GGTCACGGTG CTGGGGGAGA 601 TCAAAACGGG CAACTCTCCC GTCAAACAAT ATTTTTATGA AACGCGATGT AAGGAAGCCA 661 GGCCGGTCAA AAACGGTTGC AGGGGTATTG ATGATAAACA CTGGAACTCT CAGTGCAAAA 721 CATCCCAAAC CTACGTCCGA GCACTGACTT CAGAGAACAA TAAACTCGTG GGCTGGCGGT 781 GGATACGGAT AGACACGTCC TGTGTGTGTG CCTTGTCGAG AAAAATCGGA AGAACATGCC 841 CAACTTTCTT GTACAAAGTG GTTGATATCG GTAAGCCTAT CCCTAACCCT CTCCTCGGTC 901 TCGATTCTAC GTAGTAATGA ACTAGTCCGT AACTTGAAAG TATTTCGATT TCTTGGCTTT 961 ATATATCTTG TGGAAAGGAC GACAACAACG ACAACAATCG GATGCTACGC GTTAAGTCga 1021 caatcaacct ctggattaca aaatttgtga aagatt