Transcript: Human NM_002527.4

Homo sapiens neurotrophin 3 (NTF3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
NTF3 (4908)
Length:
1182
CDS:
84..857

Additional Resources:

NCBI RefSeq record:
NM_002527.4
NBCI Gene record:
NTF3 (4908)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002527.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000058856 CTCTCCCGTCAAACAATATTT pLKO.1 632 CDS 100% 15.000 21.000 N NTF3 n/a
2 TRCN0000378856 AGTCATCGGCCATCGACATTC pLKO_005 568 CDS 100% 10.800 15.120 N NTF3 n/a
3 TRCN0000373052 GAAACGGTACGCGGAGCATAA pLKO_005 491 CDS 100% 10.800 15.120 N NTF3 n/a
4 TRCN0000058855 CAAGGTAACAACATGGATCAA pLKO.1 132 CDS 100% 4.950 6.930 N NTF3 n/a
5 TRCN0000058853 CGCTCAATTCCCTCATTATTA pLKO.1 172 CDS 100% 15.000 12.000 N NTF3 n/a
6 TRCN0000058854 CACTGACTTCAGAGAACAATA pLKO.1 760 CDS 100% 13.200 9.240 N NTF3 n/a
7 TRCN0000058857 GTGATTGCAATGGACACCGAA pLKO.1 336 CDS 100% 2.640 1.848 N NTF3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002527.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01111 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01111 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000472807 CAACAACGACAACAATCGGATGCT pLX_317 35.9% 100% 100% V5 n/a
4 ccsbBroadEn_06659 pDONR223 100% 99.7% 100% None 252G>A;555C>T n/a
5 ccsbBroad304_06659 pLX_304 0% 99.7% 100% V5 252G>A;555C>T n/a
6 TRCN0000465758 CACGTAATGAGGTCTGCATAATCT pLX_317 44% 99.7% 100% V5 252G>A;555C>T n/a
Download CSV