Transcript: Mouse XM_006505716.2

PREDICTED: Mus musculus neurotrophin 3 (Ntf3), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ntf3 (18205)
Length:
1587
CDS:
497..1273

Additional Resources:

NCBI RefSeq record:
XM_006505716.2
NBCI Gene record:
Ntf3 (18205)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006505716.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000065439 GCTGGATACGAATAGACACTT pLKO.1 1212 CDS 100% 4.950 6.930 N Ntf3 n/a
2 TRCN0000065441 CCAAACAGATGGTGGATGTTA pLKO.1 642 CDS 100% 5.625 3.938 N Ntf3 n/a
3 TRCN0000065442 GTAACTCTCCTGTGAAACAAT pLKO.1 1044 CDS 100% 5.625 3.938 N Ntf3 n/a
4 TRCN0000065438 CCCTTACAGTATATAAGCTTT pLKO.1 1395 3UTR 100% 4.950 3.465 N Ntf3 n/a
5 TRCN0000065440 CCCTTATACCTAATGGAGGAT pLKO.1 842 CDS 100% 2.640 1.848 N Ntf3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006505716.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06659 pDONR223 100% 89.5% 95.7% None (many diffs) n/a
2 ccsbBroad304_06659 pLX_304 0% 89.5% 95.7% V5 (many diffs) n/a
3 TRCN0000465758 CACGTAATGAGGTCTGCATAATCT pLX_317 44% 89.5% 95.7% V5 (many diffs) n/a
4 ccsbBroadEn_01111 pDONR223 100% 89.2% 95.7% None (many diffs) n/a
5 ccsbBroad304_01111 pLX_304 0% 89.2% 95.7% V5 (many diffs) n/a
6 TRCN0000472807 CAACAACGACAACAATCGGATGCT pLX_317 35.9% 89.2% 95.7% V5 (many diffs) n/a
Download CSV