Construct: ORF TRCN0000472867
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF014141.1_s317c1
- Derived from:
- ccsbBroadEn_14278
- DNA Barcode:
- GTCAAGCCAACAGCGATGCTAGGA
- Epitope Tag:
- V5 (not translated due to frame shift)
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TMEM156 (80008)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472867
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 80008 | TMEM156 | transmembrane protein 156 | NM_024943.3 | 99.6% | 98.3% | 313T>C;603A>G;876delA |
| 2 | human | 80008 | TMEM156 | transmembrane protein 156 | NM_001303228.2 | 99.3% | 97.9% | (many diffs) |
| 3 | human | 80008 | TMEM156 | transmembrane protein 156 | XM_024454222.1 | 95.4% | 88.9% | (many diffs) |
| 4 | human | 80008 | TMEM156 | transmembrane protein 156 | XM_024454223.1 | 95% | 90.1% | (many diffs) |
| 5 | human | 80008 | TMEM156 | transmembrane protein 156 | XM_024454224.1 | 93.3% | 92.5% | (many diffs) |
| 6 | human | 80008 | TMEM156 | transmembrane protein 156 | XM_011513753.2 | 90.3% | 89.1% | 272_273ins84;519A>G;792delA |
| 7 | human | 80008 | TMEM156 | transmembrane protein 156 | XM_011513754.2 | 76% | 74.6% | (many diffs) |
| 8 | human | 80008 | TMEM156 | transmembrane protein 156 | XM_017008629.1 | 76% | 74.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 954
- ORF length:
- 888
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgac aaaaacagcc ctccttaaat tatttgtggc aatagtgatc acattcattt 121 taattttgcc ggaatatttc aagacaccga aagaaagaac attggagcta tcatgtctgg 181 aagtgtgttt gcaatctaat tttacctatt cactctcctc cttaaatttt tcttttgtga 241 cttttctgca accagtaagg gaaactcaga ttatcatgag aatctttcta aatccctcca 301 attttcgtaa cttcaccagg acttgccaag acatcacagg tgaatttaaa atgtgctcct 361 cgtgtttggt ttgtgagcct aaaggaaaca tggattttat ttctcaggaa caaacatcaa 421 aagttcttat caggagagga tcaatggaag tgaaagcaaa tgattttcat tcaccttgtc 481 agcactttaa cttcagtgta gctcctctgg ttgaccactt ggaggaatat aacactacct 541 gtcatctaaa aaaccacact ggaagatcaa caaTCATGGA GGATGAGCCA AGCAAGGAGA 601 AATCGATAAA CTACACTTGT AGAATCATGG AATACCCGAA TGATTGTATA CACATTTCTT 661 TGCACCTGGA GATGGATATA AAAAATATCA CTTGTTCCAT GAAGATCACT TGGTATATTT 721 TAGTTCTATT AGTTTTTATA TTTTTGATCA TCCTCACTAT CCGCAAAATA CTTGAAGGCC 781 AGAGAAGAGT GCAAAAGTGG CAGAGTCATA GAGACAAACC TACATCTGTT CTCTTAAGAG 841 GAAGTGATTC GGAGAAACTG AGAGCATTGA ATGTGCAGGT TCTTTCAGCA GAGACCACGC 901 AGAGGCTGCC TTTGGATCAA GTCCAGGAAG TGCTTCCCCC ATTCCAGAAC TATACCCAAC 961 TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC TCGGTCTCGA 1021 TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT GGCTTTATAT 1081 ATCTTGTGGA AAGGACGAGT CAAGCCAACA GCGATGCTAG GAACGCGTTA AGTCgacaat 1141 caacctctgg attacaaaat ttgtgaaaga tt