Transcript: Human XM_011513754.2

PREDICTED: Homo sapiens transmembrane protein 156 (TMEM156), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TMEM156 (80008)
Length:
2933
CDS:
582..1262

Additional Resources:

NCBI RefSeq record:
XM_011513754.2
NBCI Gene record:
TMEM156 (80008)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011513754.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430359 AGCAAGGAGAAATCGATAAAC pLKO_005 897 CDS 100% 13.200 18.480 N TMEM156 n/a
2 TRCN0000172551 GTGGCAGAGTCATAGAGACAA pLKO.1 1103 CDS 100% 4.950 3.960 N TMEM156 n/a
3 TRCN0000412896 AGACATCACAGGTGAATTTAA pLKO_005 635 CDS 100% 15.000 10.500 N TMEM156 n/a
4 TRCN0000166852 CCACATTGTAGATGCTGATTT pLKO.1 1675 3UTR 100% 13.200 9.240 N TMEM156 n/a
5 TRCN0000167529 GAAGTGTGTTTGCAATCTAAT pLKO.1 486 5UTR 100% 13.200 9.240 N TMEM156 n/a
6 TRCN0000431087 GTAAGGGAAACTCAGATTATC pLKO_005 561 5UTR 100% 13.200 9.240 N TMEM156 n/a
7 TRCN0000168237 CCACACTGGAAGATCAACAAT pLKO.1 860 CDS 100% 5.625 3.938 N TMEM156 n/a
8 TRCN0000167921 CCATGGAAACAGCAAGAGAAT pLKO.1 1536 3UTR 100% 4.950 3.465 N TMEM156 n/a
9 TRCN0000168365 GCATTGAATGTGCAGGTTCTT pLKO.1 1170 CDS 100% 4.950 2.970 N TMEM156 n/a
10 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 1938 3UTR 100% 4.950 2.475 Y ORAI2 n/a
11 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1863 3UTR 100% 13.200 6.600 Y LIAS n/a
12 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 1935 3UTR 100% 4.950 2.475 Y LOC339059 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011513754.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14278 pDONR223 100% 76% 74.6% None (many diffs) n/a
2 ccsbBroad304_14278 pLX_304 0% 76% 74.6% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000472867 GTCAAGCCAACAGCGATGCTAGGA pLX_317 42.9% 76% 74.6% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV