Transcript: Human NM_001303228.2

Homo sapiens transmembrane protein 156 (TMEM156), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
TMEM156 (80008)
Length:
1920
CDS:
97..984

Additional Resources:

NCBI RefSeq record:
NM_001303228.2
NBCI Gene record:
TMEM156 (80008)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001303228.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430359 AGCAAGGAGAAATCGATAAAC pLKO_005 622 CDS 100% 13.200 18.480 N TMEM156 n/a
2 TRCN0000172551 GTGGCAGAGTCATAGAGACAA pLKO.1 828 CDS 100% 4.950 3.960 N TMEM156 n/a
3 TRCN0000412896 AGACATCACAGGTGAATTTAA pLKO_005 360 CDS 100% 15.000 10.500 N TMEM156 n/a
4 TRCN0000166852 CCACATTGTAGATGCTGATTT pLKO.1 1397 3UTR 100% 13.200 9.240 N TMEM156 n/a
5 TRCN0000167529 GAAGTGTGTTTGCAATCTAAT pLKO.1 211 CDS 100% 13.200 9.240 N TMEM156 n/a
6 TRCN0000431087 GTAAGGGAAACTCAGATTATC pLKO_005 286 CDS 100% 13.200 9.240 N TMEM156 n/a
7 TRCN0000168237 CCACACTGGAAGATCAACAAT pLKO.1 585 CDS 100% 5.625 3.938 N TMEM156 n/a
8 TRCN0000167921 CCATGGAAACAGCAAGAGAAT pLKO.1 1258 3UTR 100% 4.950 3.465 N TMEM156 n/a
9 TRCN0000168365 GCATTGAATGTGCAGGTTCTT pLKO.1 895 CDS 100% 4.950 2.970 N TMEM156 n/a
10 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 1660 3UTR 100% 4.950 2.475 Y ORAI2 n/a
11 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1585 3UTR 100% 13.200 6.600 Y LIAS n/a
12 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 1657 3UTR 100% 4.950 2.475 Y LOC339059 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001303228.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14278 pDONR223 100% 99.3% 97.9% None (many diffs) n/a
2 ccsbBroad304_14278 pLX_304 0% 99.3% 97.9% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000472867 GTCAAGCCAACAGCGATGCTAGGA pLX_317 42.9% 99.3% 97.9% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV