Construct: ORF TRCN0000472881
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013760.1_s317c1
- Derived from:
- ccsbBroadEn_12792
- DNA Barcode:
- AACGAATAAGCCATGACACAAATA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- USP48 (84196)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472881
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 84196 | USP48 | ubiquitin specific peptidas... | NM_001032730.2 | 91.2% | 89.8% | 1302_1303insT;1329_1455del |
2 | human | 84196 | USP48 | ubiquitin specific peptidas... | XM_017002496.2 | 58.2% | 57.4% | 1302_1303insT;1329_2277del |
3 | human | 84196 | USP48 | ubiquitin specific peptidas... | XM_006710955.4 | 45.6% | 44.9% | 1302_1303insT;1329_2907del |
4 | human | 84196 | USP48 | ubiquitin specific peptidas... | NM_001350164.2 | 45.5% | 44.8% | 1169_1170insAGC;1299_1300insT;1326_2904del |
5 | human | 84196 | USP48 | ubiquitin specific peptidas... | NM_001330394.2 | 45% | 44.3% | 1302_1303insT;1329_2949del |
6 | human | 84196 | USP48 | ubiquitin specific peptidas... | NM_001350168.2 | 42.7% | 42.1% | 1302_1303insT;1329_3102del |
7 | human | 84196 | USP48 | ubiquitin specific peptidas... | NM_032236.8 | 42.7% | 42.1% | 1302_1303insT;1329_3105del |
8 | human | 84196 | USP48 | ubiquitin specific peptidas... | NM_001350166.2 | 42.7% | 42% | 1169_1170insAGC;1299_1300insT;1326_3099del |
9 | human | 84196 | USP48 | ubiquitin specific peptidas... | NM_001350167.2 | 42.6% | 42% | 1169_1170insAGC;1299_1300insT;1326_3102del |
10 | human | 84196 | USP48 | ubiquitin specific peptidas... | XM_011542264.1 | 36.2% | 34.2% | (many diffs) |
11 | human | 84196 | USP48 | ubiquitin specific peptidas... | XR_002957781.1 | 35.6% | 1_218del;1520_1521insT;1547_3726del | |
12 | human | 84196 | USP48 | ubiquitin specific peptidas... | XR_001737480.2 | 34.6% | 1_218del;1520_1521insT;1547_3833del | |
13 | human | 84196 | USP48 | ubiquitin specific peptidas... | XR_001737479.2 | 34.6% | 1_218del;1520_1521insT;1547_3836del | |
14 | human | 84196 | USP48 | ubiquitin specific peptidas... | XM_011542265.3 | 30.4% | 29.8% | 0_1ins381;921_922insT;948_2724del |
15 | human | 84196 | USP48 | ubiquitin specific peptidas... | XR_001737482.2 | 16.2% | 1_218del;1520_1521insT;1547_8154del | |
16 | mouse | 170707 | Usp48 | ubiquitin specific peptidas... | XM_017320011.1 | 38.1% | 41.1% | (many diffs) |
17 | mouse | 170707 | Usp48 | ubiquitin specific peptidas... | XM_017320009.1 | 37.5% | 40.4% | (many diffs) |
18 | mouse | 170707 | Usp48 | ubiquitin specific peptidas... | NM_001347227.1 | 37.5% | 40.4% | (many diffs) |
19 | mouse | 170707 | Usp48 | ubiquitin specific peptidas... | XM_017320010.1 | 37.4% | 40.3% | (many diffs) |
20 | mouse | 170707 | Usp48 | ubiquitin specific peptidas... | XM_017320013.1 | 37.4% | 40.3% | (many diffs) |
21 | mouse | 170707 | Usp48 | ubiquitin specific peptidas... | XM_017320006.1 | 36.8% | 39.7% | (many diffs) |
22 | mouse | 170707 | Usp48 | ubiquitin specific peptidas... | XM_017320005.1 | 36.8% | 39.7% | (many diffs) |
23 | mouse | 170707 | Usp48 | ubiquitin specific peptidas... | NM_130879.2 | 36.8% | 39.6% | (many diffs) |
24 | mouse | 170707 | Usp48 | ubiquitin specific peptidas... | XM_017320007.1 | 36.7% | 39.6% | (many diffs) |
25 | mouse | 170707 | Usp48 | ubiquitin specific peptidas... | XR_001784098.1 | 21.6% | (many diffs) | |
26 | mouse | 170707 | Usp48 | ubiquitin specific peptidas... | XR_001784100.1 | 20.3% | (many diffs) | |
27 | mouse | 170707 | Usp48 | ubiquitin specific peptidas... | XR_001784099.1 | 20.1% | (many diffs) | |
28 | mouse | 170707 | Usp48 | ubiquitin specific peptidas... | XR_001784101.1 | 19.4% | (many diffs) | |
29 | mouse | 170707 | Usp48 | ubiquitin specific peptidas... | XR_001784102.1 | 12% | (many diffs) | |
30 | mouse | 170707 | Usp48 | ubiquitin specific peptidas... | XR_001784103.1 | 12% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1395
- ORF length:
- 1329
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc cccgcggctg cagctggaga aggcggcctg gcgctgggcg gagacggtgc 121 ggcccgagga ggtgtcgcag gagcacatcg agaccgctta ccgcatctgg ctggagccct 181 gcattcgcgg cgtgtgcaga cgaaactgca aaggaaatcc gaattgcttg gttggtattg 241 gtgagcatat ttggttagga gaaatagatg aaaatagttt tcataacatc gatgatccca 301 actgtgagag gagaaaaaag aactcatttg tgggcctgac taaccttgga gccacttgtt 361 atgtcaacac atttcttcaa gtgtggtttc tcaacttgga gcttcggcag gcactctact 421 tatgtccaag cacttgtagt gactacatgc tgggagacgg catccaagaa gaaaaagatt 481 atgagcctca aacaatttgt gagcatctcc agtacttgtt tgccttgttg caaaacagta 541 ataggcgata cattgatcca tcaggatttg ttaaagcctt gggcctggac actggacaac 601 agcaggatgc tcaagaattt tcaaagctct ttatgtctct attggaagat actttgtcta 661 aacaaaagaa tccagatgtg cgcaatattg ttcaacagca gttctgtgga gaatatgcct 721 atgtaactgt ttgcaaccag tgtggcagag agtctaagct tttgtcaaaa ttttatgagc 781 tggagttaaa tatccaaggc cacaaacagt taacagattg tatctcGGAA TTTTTGAAGG 841 AAGAAAAATT AGAAGGAGAC AATCGCTATT TTTGCGAGAA CTGTCAAAGC AAACAGAATG 901 CAACAAGAAA GATTCGACTT CTTAGCCTTC CTTGCACTCT GAACTTGCAG CTAATGCGTT 961 TTGTCTTTGA CAGGCAAACT GGACATAAGA AAAAGCTGAA TACCTACATT GGCTTCTCAG 1021 AAATTTTGGA TATGGAGCCT TATGTGGAAC ATAAAGGTGG GTCCTACGTG TATGAACTCA 1081 GCGCAGTCCT CATACACAGA GGAGTGAGTG CTTATTCTGG CCACTACATC GCCCACGTGA 1141 AAGATCCACA GTCTGGTGAA TGGTATAAGT TTAATGATGA AGACATAGAA AAGATGGAGG 1201 GGAAGAAATT ACAACTAGGG ATTGAGGAAG ATCTAGCAGA ACCTTCTAAG TCTCAGACAC 1261 GTAAACCCAA GTGTGGCAAA GGAACTCATT GCTCTCGAAA TGCATATATG TTGGTTTATA 1321 GACTGCAAAC TCAAGAAAAG CCCAACACTA CTGTTCAAGT TCCAGCCTTT TCTTCAAGAG 1381 CTGGTAGATC GGGATACCCA ACTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 1441 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 1501 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA AACGAATAAG CCATGACACA 1561 AATAACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt