Transcript: Human XR_001737479.2

PREDICTED: Homo sapiens ubiquitin specific peptidase 48 (USP48), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
USP48 (84196)
Length:
3836
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001737479.2
NBCI Gene record:
USP48 (84196)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001737479.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000295937 TTGGTATTGGTGAGCATATTT pLKO_005 385 3UTR 100% 15.000 21.000 N USP48 n/a
2 TRCN0000038830 GCCACCATCTATGTCCATAAA pLKO.1 2797 3UTR 100% 13.200 18.480 N USP48 n/a
3 TRCN0000038833 GCGTCTGAAGAACCAACTAAA pLKO.1 1913 3UTR 100% 13.200 18.480 N USP48 n/a
4 TRCN0000038831 GCGTAAGCAAAGTGTGGATAA pLKO.1 1589 3UTR 100% 10.800 15.120 N USP48 n/a
5 TRCN0000298778 GCGTAAGCAAAGTGTGGATAA pLKO_005 1589 3UTR 100% 10.800 15.120 N USP48 n/a
6 TRCN0000038832 CCACTTGTTATGTCAACACAT pLKO.1 505 3UTR 100% 4.950 3.960 N USP48 n/a
7 TRCN0000298718 CCACTTGTTATGTCAACACAT pLKO_005 505 3UTR 100% 4.950 3.960 N USP48 n/a
8 TRCN0000307997 CCAGATGCGTTGGTCCATAAA pLKO_005 3685 3UTR 100% 13.200 9.240 N USP48 n/a
9 TRCN0000295936 GAATCCAGATGTGCGCAATAT pLKO_005 821 3UTR 100% 13.200 9.240 N USP48 n/a
10 TRCN0000038829 GCATTAAAGCAAAGGTGGATT pLKO.1 3385 3UTR 100% 4.950 3.465 N USP48 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001737479.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12792 pDONR223 100% 34.6% None 1_218del;1520_1521insT;1547_3836del n/a
2 ccsbBroad304_12792 pLX_304 0% 34.6% V5 1_218del;1520_1521insT;1547_3836del n/a
3 TRCN0000472881 AACGAATAAGCCATGACACAAATA pLX_317 42.9% 34.6% V5 1_218del;1520_1521insT;1547_3836del n/a
4 ccsbBroadEn_12793 pDONR223 100% 19.7% None 1_2561del;2602_2603insTATAG;3319_3836del n/a
5 ccsbBroad304_12793 pLX_304 0% 19.7% V5 1_2561del;2602_2603insTATAG;3319_3836del n/a
6 TRCN0000473772 TTGATGTTGGAGTCAAATGCATTT pLX_317 65.7% 19.7% V5 1_2561del;2602_2603insTATAG;3319_3836del n/a
Download CSV