Construct: ORF TRCN0000472912
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF005276.1_s317c1
- Derived from:
- ccsbBroadEn_13066
- DNA Barcode:
- TCACCCCCCAAACTAAGCGAGGAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RFFL (117584)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472912
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 117584 | RFFL | ring finger and FYVE like d... | NM_001017368.2 | 89.9% | 89.8% | 380A>G;589_672del;886_909del |
2 | human | 117584 | RFFL | ring finger and FYVE like d... | NR_037713.2 | 13.6% | (many diffs) | |
3 | mouse | 67338 | Rffl | ring finger and FYVE like d... | NM_026097.3 | 87.5% | 88.3% | (many diffs) |
4 | mouse | 67338 | Rffl | ring finger and FYVE like d... | NM_001164571.1 | 87.2% | 88% | (many diffs) |
5 | mouse | 67338 | Rffl | ring finger and FYVE like d... | NM_001007465.3 | 80.7% | 81.5% | (many diffs) |
6 | mouse | 67338 | Rffl | ring finger and FYVE like d... | XM_006533988.2 | 80.7% | 81.5% | (many diffs) |
7 | mouse | 67338 | Rffl | ring finger and FYVE like d... | XM_006533989.2 | 80.7% | 81.5% | (many diffs) |
8 | mouse | 67338 | Rffl | ring finger and FYVE like d... | XM_006533990.2 | 80.7% | 81.5% | (many diffs) |
9 | mouse | 67338 | Rffl | ring finger and FYVE like d... | XM_006533987.2 | 79.2% | 80% | (many diffs) |
10 | mouse | 67338 | Rffl | ring finger and FYVE like d... | NM_001164570.1 | 77.7% | 78.5% | (many diffs) |
11 | mouse | 67338 | Rffl | ring finger and FYVE like d... | NM_001164569.1 | 73.6% | 74.3% | (many diffs) |
12 | mouse | 67338 | Rffl | ring finger and FYVE like d... | XM_017314715.1 | 73.6% | 74.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1047
- ORF length:
- 981
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtg ggcaacctgc tgcaactggt tctgcctgga tggacagcct gaggaggtcc 121 caccacccca gggagccagg atgcaggcct attccaaccc tgggtacagc tccttccctt 181 ccccaacagg cttggaacca agctgcaagt cctgtggggc tcactttgca aacacggcca 241 ggaagcagac ctgcttggac tgtaagaaaa atttttgcat gacctgttcg agccaagtag 301 ggaatgggcc ccgcctctgc cttctctgcc aacggtttcg agctacagcc tttcagcgag 361 aggagctcat gaagatgaag gtgaaggact tgagggacta tctcagcctc catgacatct 421 ctaccgaaat gtgccgggag aaaggagagc tggtgctctt ggtccttggc cagcagcctg 481 taatctccca ggaggacagg actcgtgcct ccaccttgtc cccagacttt cctgagcagc 541 aggccttcct gacccagcct cactccagca tggttccacc tacctcaccc aacctcccct 601 cttcatcTGC ACAAGCCACC TCTGTTCCCC CAGCCCAGGT TCAGGAGAAT CAGCAGTCTA 661 TTGACTCAGA GGACAGCTTT GTCCCAGGCC GAAGGGCCTC TCTGTCTGAC CTGACTGACC 721 TGGAGGACAT TGAAGGCCTG ACAGTGCGGC AGCTGAAAGA GATCTTGGCT CGCAACTTTG 781 TCAACTACAA GGGCTGCTGT GAGAAGTGGG AGCTGATGGA GAGAGTGACC CGGCTATACA 841 AGGATCAGAA AGGACTCCAG CACCTGGGGG GAGCAGTACC ATCAGGCTTG GAGGAGAACC 901 TGTGTAAGAT CTGCATGGAC TCACCCATTG ACTGTGTTCT TCTGGAGTGT GGCCACATGG 961 TAACCTGTAC CAAGTGTGGC AAGCGCATGA ATGAATGTCC CATCTGCCGG CAGTATGTAA 1021 TCCGAGCTGT GCATGTCTTC CGGTCCTGCC CAACTTTCTT GTACAAAGTG GTTGATATCG 1081 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 1141 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GATCACCCCC 1201 CAAACTAAGC GAGGATACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 1261 aagatt