Transcript: Human NM_001017368.2

Homo sapiens ring finger and FYVE like domain containing E3 ubiquitin protein ligase (RFFL), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
RFFL (117584)
Length:
7210
CDS:
141..1232

Additional Resources:

NCBI RefSeq record:
NM_001017368.2
NBCI Gene record:
RFFL (117584)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001017368.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000034076 CCATGACATCTCTACCGAAAT pLKO.1 485 CDS 100% 10.800 8.640 N RFFL n/a
2 TRCN0000430991 TGAAGGACTTGAGGGACTATC pLKO_005 457 CDS 100% 10.800 7.560 N RFFL n/a
3 TRCN0000034077 ACCTGCTTGGACTGTAAGAAA pLKO.1 324 CDS 100% 5.625 3.938 N RFFL n/a
4 TRCN0000040622 GACCTGCTTGGACTGTAAGAA pLKO.1 323 CDS 100% 5.625 3.938 N Rffl n/a
5 TRCN0000324054 GACCTGCTTGGACTGTAAGAA pLKO_005 323 CDS 100% 5.625 3.938 N Rffl n/a
6 TRCN0000412868 TCTGTGCTTTAACTATCTTTG pLKO_005 1682 3UTR 100% 10.800 5.400 Y RFFL n/a
7 TRCN0000034074 CCGGCTATACAAGGATCAGAA pLKO.1 989 CDS 100% 4.950 2.475 Y RFFL n/a
8 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 4289 3UTR 100% 4.950 2.475 Y ERAP2 n/a
9 TRCN0000034078 GCAGTATGTAATCCGAGCTGT pLKO.1 1193 CDS 100% 2.640 1.320 Y RFFL n/a
10 TRCN0000034075 CCACATGGTAACCTGTACCAA pLKO.1 1136 CDS 100% 0.300 0.150 Y RFFL n/a
11 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 4290 3UTR 100% 13.200 6.600 Y LIAS n/a
12 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2686 3UTR 100% 5.625 2.813 Y KLHL30 n/a
13 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2686 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001017368.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13066 pDONR223 100% 89.9% 89.8% None 380A>G;589_672del;886_909del n/a
2 ccsbBroad304_13066 pLX_304 0% 89.9% 89.8% V5 380A>G;589_672del;886_909del n/a
3 TRCN0000472912 TCACCCCCCAAACTAAGCGAGGAT pLX_317 44.9% 89.9% 89.8% V5 380A>G;589_672del;886_909del n/a
Download CSV