Transcript: Mouse XM_006533987.2

PREDICTED: Mus musculus ring finger and FYVE like domain containing protein (Rffl), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rffl (67338)
Length:
3578
CDS:
279..1391

Additional Resources:

NCBI RefSeq record:
XM_006533987.2
NBCI Gene record:
Rffl (67338)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006533987.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000040618 CCACGACATCTCTACGGAAAT pLKO.1 728 CDS 100% 10.800 15.120 N Rffl n/a
2 TRCN0000323993 CCACGACATCTCTACGGAAAT pLKO_005 728 CDS 100% 10.800 15.120 N Rffl n/a
3 TRCN0000040619 CGGCTGTACAAGGATCAGAAA pLKO.1 1149 CDS 100% 4.950 6.930 N Rffl n/a
4 TRCN0000324055 CGGCTGTACAAGGATCAGAAA pLKO_005 1149 CDS 100% 4.950 6.930 N Rffl n/a
5 TRCN0000040620 CTCGTAACTTTGTCAACTATA pLKO.1 1087 CDS 100% 13.200 9.240 N Rffl n/a
6 TRCN0000323991 CTCGTAACTTTGTCAACTATA pLKO_005 1087 CDS 100% 13.200 9.240 N Rffl n/a
7 TRCN0000034077 ACCTGCTTGGACTGTAAGAAA pLKO.1 567 CDS 100% 5.625 3.938 N RFFL n/a
8 TRCN0000040622 GACCTGCTTGGACTGTAAGAA pLKO.1 566 CDS 100% 5.625 3.938 N Rffl n/a
9 TRCN0000324054 GACCTGCTTGGACTGTAAGAA pLKO_005 566 CDS 100% 5.625 3.938 N Rffl n/a
10 TRCN0000040621 GAACCTGTGTAAGATTTGCAT pLKO.1 1238 CDS 100% 3.000 2.100 N Rffl n/a
11 TRCN0000324057 GAACCTGTGTAAGATTTGCAT pLKO_005 1238 CDS 100% 3.000 2.100 N Rffl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006533987.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13066 pDONR223 100% 79.2% 80% None (many diffs) n/a
2 ccsbBroad304_13066 pLX_304 0% 79.2% 80% V5 (many diffs) n/a
3 TRCN0000472912 TCACCCCCCAAACTAAGCGAGGAT pLX_317 44.9% 79.2% 80% V5 (many diffs) n/a
Download CSV