Construct: ORF TRCN0000472948
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF001865.1_s317c1
- Derived from:
- ccsbBroadEn_02821
- DNA Barcode:
- GCCTGCTTGCGCAGTGTAGAACTA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PLD3 (23646)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472948
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 23646 | PLD3 | phospholipase D family memb... | NM_001031696.3 | 100% | 100% | |
2 | human | 23646 | PLD3 | phospholipase D family memb... | NM_001291311.1 | 100% | 100% | |
3 | human | 23646 | PLD3 | phospholipase D family memb... | NM_012268.4 | 100% | 100% | |
4 | human | 23646 | PLD3 | phospholipase D family memb... | XM_005258704.2 | 100% | 100% | |
5 | human | 23646 | PLD3 | phospholipase D family memb... | XM_005258707.4 | 100% | 100% | |
6 | human | 23646 | PLD3 | phospholipase D family memb... | XM_005258708.4 | 100% | 100% | |
7 | human | 23646 | PLD3 | phospholipase D family memb... | XM_005258709.4 | 100% | 100% | |
8 | human | 23646 | PLD3 | phospholipase D family memb... | XM_005258710.5 | 100% | 100% | |
9 | human | 23646 | PLD3 | phospholipase D family memb... | XM_006723122.1 | 100% | 100% | |
10 | human | 23646 | PLD3 | phospholipase D family memb... | XM_011526692.1 | 100% | 100% | |
11 | human | 23646 | PLD3 | phospholipase D family memb... | XM_011526693.1 | 100% | 100% | |
12 | human | 23646 | PLD3 | phospholipase D family memb... | XM_017026546.1 | 100% | 100% | |
13 | human | 23646 | PLD3 | phospholipase D family memb... | XM_017026548.1 | 100% | 100% | |
14 | human | 23646 | PLD3 | phospholipase D family memb... | XM_017026549.1 | 100% | 100% | |
15 | human | 23646 | PLD3 | phospholipase D family memb... | XM_024451438.1 | 100% | 100% | |
16 | mouse | 18807 | Pld3 | phospholipase D family, mem... | NM_001317355.1 | 87.8% | 93.2% | (many diffs) |
17 | mouse | 18807 | Pld3 | phospholipase D family, mem... | NM_011116.2 | 87.8% | 93.2% | (many diffs) |
18 | mouse | 18807 | Pld3 | phospholipase D family, mem... | XM_006539642.2 | 87.8% | 93.2% | (many diffs) |
19 | mouse | 18807 | Pld3 | phospholipase D family, mem... | XM_006539643.2 | 87.8% | 93.2% | (many diffs) |
20 | mouse | 18807 | Pld3 | phospholipase D family, mem... | XM_017322042.1 | 78.4% | 83% | (many diffs) |
21 | mouse | 18807 | Pld3 | phospholipase D family, mem... | XM_006539645.2 | 74.9% | 77.9% | (many diffs) |
22 | mouse | 18807 | Pld3 | phospholipase D family, mem... | XM_006539646.2 | 74.9% | 77.9% | (many diffs) |
23 | mouse | 18807 | Pld3 | phospholipase D family, mem... | XM_011250456.1 | 74.9% | 77.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1536
- ORF length:
- 1470
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa gcctaaactg atgtaccagg agctgaaggt gcctgcagag gagcccgcca 121 atgagctgcc catgaatgag attgaggcgt ggaaggctgc ggaaaagaaa gcccgctggg 181 tcctgctggt cctcattctg gcggttgtgg gcttcggagc cctgatgact cagctgtttc 241 tatgggaata cggcgacttg catctctttg ggcccaacca gcgcccagcc ccctgctatg 301 acccttgcga agcagtgctg gtggaaagca ttcctgaggg cctggacttc cccaatgcct 361 ccacggggaa cccttccacc agccaggcct ggctgggcct gctcgccggt gcgcacagca 421 gcctggacat cgcctccttc tactggaccc tcaccaacaa tgacacccac acgcaggagc 481 cctctgccca gcagggtgag gaggtcctcc ggcagctgca gaccctggca ccaaagggcg 541 tgaacgtccg catcgctgtg agcaagccca gcgggcccca gccacaggcg gacctgcagg 601 ctctgctgca gagcggtgcc caggtccgca tggtggacat gcagaagctg acccatggcg 661 tcctgcatac caagttctgg gtggtggacc agacccactt ctacctgggc agtgccaaca 721 tggactggcg ttcactgacc caggtcaagg agctgggcgt ggtcatgtac aactgcagct 781 gcctggctcg agacctgacc aagatctttg aggcctactg gttcctgggc caggcaggca 841 gctccatccc atcaacttgg ccccggttct atgacacccg ctacaaccaa gagacaccaa 901 tggagatctg cctcaatgga acccctgctc tggcctacct ggcgagtgcg cccccacccc 961 tgtgtccaag tggccgcact ccagacctga aggctctact caacgtggtg gacaatgccc 1021 ggagtttcat ctacgtcgct gtcatgaact acctgcccac tctggagttc tcccaccctc 1081 acaggttctg gcctgccatt gacgatgggc tgcggcgggc cacctacgag cgtggcgtca 1141 aggtgcgcct gctcatcagc tgctggggac actcggagcc atccatgcgg gccttcctgc 1201 tctctctggc tgcccTGCGT GACAACCATA CCCACTCTGA CATCCAGGTG AAACTCTTTG 1261 TGGTCCCCGC GGATGAGGCC CAGGCTCGAA TCCCATATGC CCGTGTCAAC CACAACAAGT 1321 ACATGGTGAC TGAACGCGCC ACCTACATCG GAACCTCCAA CTGGTCTGGC AACTACTTCA 1381 CGGAGACGGC GGGCACCTCG CTGCTGGTGA CGCAGAATGG GAGGGGCGGC CTGCGGAGCC 1441 AGCTGGAGGC CATTTTCCTG AGGGACTGGG ACTCCCCTTA CAGCCATGAC CTTGACACCT 1501 CAGCTGACAG CGTGGGCAAC GCCTGCCGCC TGCTCTGCCC AACTTTCTTG TACAAAGTGG 1561 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 1621 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 1681 AGCCTGCTTG CGCAGTGTAG AACTAACGCG TTAAGTCgac aatcaacctc tggattacaa 1741 aatttgtgaa agatt