Transcript: Human XM_005258708.4

PREDICTED: Homo sapiens phospholipase D family member 3 (PLD3), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PLD3 (23646)
Length:
1908
CDS:
124..1596

Additional Resources:

NCBI RefSeq record:
XM_005258708.4
NBCI Gene record:
PLD3 (23646)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005258708.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000052164 CCCTGCTATGACCCTTGCGAA pLKO.1 349 CDS 100% 0.880 1.232 N PLD3 n/a
2 TRCN0000052166 CGAGACCTGACCAAGATCTTT pLKO.1 847 CDS 100% 5.625 4.500 N PLD3 n/a
3 TRCN0000052165 CTACTCAACGTGGTGGACAAT pLKO.1 1054 CDS 100% 4.950 3.960 N PLD3 n/a
4 TRCN0000052167 CCGTGTCAACCACAACAAGTA pLKO.1 1359 CDS 100% 4.950 3.465 N PLD3 n/a
5 TRCN0000052163 CACTCTGACATCCAGGTGAAA pLKO.1 1291 CDS 100% 4.950 2.970 N PLD3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005258708.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02821 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02821 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000472948 GCCTGCTTGCGCAGTGTAGAACTA pLX_317 22.2% 100% 100% V5 n/a
Download CSV