Transcript: Mouse XM_006539643.2

PREDICTED: Mus musculus phospholipase D family, member 3 (Pld3), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pld3 (18807)
Length:
2529
CDS:
410..1876

Additional Resources:

NCBI RefSeq record:
XM_006539643.2
NBCI Gene record:
Pld3 (18807)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006539643.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000076942 GTCCTTTGACACCCGATATAA pLKO.1 1204 CDS 100% 15.000 21.000 N Pld3 n/a
2 TRCN0000326767 GTCCTTTGACACCCGATATAA pLKO_005 1204 CDS 100% 15.000 21.000 N Pld3 n/a
3 TRCN0000076941 CTTCATCTACATTGCGGTTAT pLKO.1 1363 CDS 100% 10.800 15.120 N Pld3 n/a
4 TRCN0000326765 CTTCATCTACATTGCGGTTAT pLKO_005 1363 CDS 100% 10.800 15.120 N Pld3 n/a
5 TRCN0000076939 CCTTGAATGAAATCGAGGCAT pLKO.1 474 CDS 100% 2.640 3.696 N Pld3 n/a
6 TRCN0000326694 CCTTGAATGAAATCGAGGCAT pLKO_005 474 CDS 100% 2.640 3.696 N Pld3 n/a
7 TRCN0000076940 CCAAGATCTTTGAAGCCTATT pLKO.1 1137 CDS 100% 10.800 8.640 N Pld3 n/a
8 TRCN0000326766 CCAAGATCTTTGAAGCCTATT pLKO_005 1137 CDS 100% 10.800 8.640 N Pld3 n/a
9 TRCN0000052167 CCGTGTCAACCACAACAAGTA pLKO.1 1639 CDS 100% 4.950 3.465 N PLD3 n/a
10 TRCN0000076938 TCCACTATACTCCTGCTGCTA pLKO.1 1990 3UTR 100% 2.640 1.584 N Pld3 n/a
11 TRCN0000326695 TCCACTATACTCCTGCTGCTA pLKO_005 1990 3UTR 100% 2.640 1.584 N Pld3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006539643.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02821 pDONR223 100% 87.8% 93.2% None (many diffs) n/a
2 ccsbBroad304_02821 pLX_304 0% 87.8% 93.2% V5 (many diffs) n/a
3 TRCN0000472948 GCCTGCTTGCGCAGTGTAGAACTA pLX_317 22.2% 87.8% 93.2% V5 (many diffs) n/a
Download CSV