Construct: ORF TRCN0000472953
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF012486.1_s317c1
- Derived from:
- ccsbBroadEn_08468
- DNA Barcode:
- GATTAACTCCATCATTCTTGGTTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TMEM51 (55092)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472953
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 55092 | TMEM51 | transmembrane protein 51 | NM_001136216.2 | 99.8% | 100% | 600G>A |
| 2 | human | 55092 | TMEM51 | transmembrane protein 51 | NM_001136217.1 | 99.8% | 100% | 600G>A |
| 3 | human | 55092 | TMEM51 | transmembrane protein 51 | NM_001136218.2 | 99.8% | 100% | 600G>A |
| 4 | human | 55092 | TMEM51 | transmembrane protein 51 | NM_018022.3 | 99.8% | 100% | 600G>A |
| 5 | human | 55092 | TMEM51 | transmembrane protein 51 | XM_005245919.1 | 99.8% | 100% | 600G>A |
| 6 | human | 55092 | TMEM51 | transmembrane protein 51 | XM_011541676.1 | 99.8% | 100% | 600G>A |
| 7 | human | 55092 | TMEM51 | transmembrane protein 51 | XM_017001590.1 | 99.8% | 100% | 600G>A |
| 8 | human | 55092 | TMEM51 | transmembrane protein 51 | NM_001319665.2 | 53.3% | 45% | 341_342insCAGC;405_406ins350 |
| 9 | human | 55092 | TMEM51 | transmembrane protein 51 | NR_135082.2 | 30% | (many diffs) | |
| 10 | mouse | 214359 | Tmem51 | transmembrane protein 51 | NM_145402.3 | 82.2% | 84.5% | (many diffs) |
| 11 | mouse | 214359 | Tmem51 | transmembrane protein 51 | XM_006538713.3 | 82.2% | 84.5% | (many diffs) |
| 12 | mouse | 214359 | Tmem51 | transmembrane protein 51 | XM_006538714.2 | 82.2% | 84.5% | (many diffs) |
| 13 | mouse | 214359 | Tmem51 | transmembrane protein 51 | XM_006538715.3 | 82.2% | 84.5% | (many diffs) |
| 14 | mouse | 214359 | Tmem51 | transmembrane protein 51 | XM_006538717.3 | 82.2% | 84.5% | (many diffs) |
| 15 | mouse | 214359 | Tmem51 | transmembrane protein 51 | XM_011250227.1 | 82.2% | 84.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 825
- ORF length:
- 759
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgat ggcccagtcc aaggccaatg gctcgcacta tgcgctgacc gccatcggcc 121 tggggatgct ggtccttggg gtgatcatgg ccatgtggaa cctggtaccc ggcttcagcg 181 cggccgagaa gccaacagct cagggcagca acaagaccga ggtgggtggc ggcatcctca 241 agagcaagac cttctctgtg gcctacgtgc tggtcggggc cggggtgatg ctgctgctgc 301 tttctatctg cctgagtatc agggataaga ggaagcagcg gcagggcgag gacctggccc 361 atgtccagca cccgacaggc gctgggcctc acgcccagga ggaagacagc caggaggaag 421 aagaggagga tgaggaggct gcctcaaggt actatgttcc cagcTACGAG GAAGTGATGA 481 ACACAAACTA CTCAGAAGCA AGGGGAGAGG AGCAGAACCC GAGGTTGAGC ATCTCTCTCC 541 CGTCCTATGA GTCACTGACG GGGCTCGACG AGACCACCCC CACATCCACC AGGGCTGACG 601 TGGAGGCCAG CCCTGGGAAC CCCCCTGACA GGCAGAACTC TAAGTTGGCC AAACGACTGA 661 AACCACTGAA AGTTCGAAGG ATTAAATCTG AAAAGCTTCA CCTCAAAGAC TTTAGGATCA 721 ACCTCCCAGA CAAAAACGTC CCTCCTCCCT CGATAGAGCC TTTGACTCCT CCACCGCAGT 781 ATGATGAAGT CCAGGAGAAG GCCCCCGACA CCCGGCCGCC CGACTGCCCA ACTTTCTTGT 841 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 901 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 961 GAAAGGACGA GATTAACTCC ATCATTCTTG GTTCACGCGT TAAGTCgaca atcaacctct 1021 ggattacaaa atttgtgaaa gatt