Transcript: Mouse XM_006538713.3

PREDICTED: Mus musculus transmembrane protein 51 (Tmem51), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tmem51 (214359)
Length:
1719
CDS:
274..1023

Additional Resources:

NCBI RefSeq record:
XM_006538713.3
NBCI Gene record:
Tmem51 (214359)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006538713.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246896 CTCAAAGTTCGAAGGATTAAA pLKO_005 862 CDS 100% 15.000 21.000 N Tmem51 n/a
2 TRCN0000246895 CGATCCCTAGTGACTCGTTTA pLKO_005 1311 3UTR 100% 10.800 15.120 N Tmem51 n/a
3 TRCN0000217841 CTGGTTCTTTGAAGGTCTAAG pLKO.1 1539 3UTR 100% 10.800 7.560 N Tmem51 n/a
4 TRCN0000246897 GAACCCAAGACTGAGCATTTC pLKO_005 711 CDS 100% 10.800 7.560 N Tmem51 n/a
5 TRCN0000246894 TGGTTTCAGCCCTGCGGATAA pLKO_005 378 CDS 100% 10.800 7.560 N Tmem51 n/a
6 TRCN0000246898 CAACGTCTCAGGGCAACAAGA pLKO_005 401 CDS 100% 4.950 3.465 N Tmem51 n/a
7 TRCN0000194451 GAGCTACGAGGAAGTGATGAA pLKO.1 657 CDS 100% 4.950 3.465 N Tmem51 n/a
8 TRCN0000175379 CCACTCAAAGTTCGAAGGATT pLKO.1 859 CDS 100% 4.950 2.970 N Tmem51 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006538713.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08468 pDONR223 100% 82.2% 84.5% None (many diffs) n/a
2 ccsbBroad304_08468 pLX_304 0% 82.2% 84.5% V5 (many diffs) n/a
3 TRCN0000472953 GATTAACTCCATCATTCTTGGTTC pLX_317 47.6% 82.2% 84.5% V5 (many diffs) n/a
4 ccsbBroadEn_03520 pDONR223 100% 82% 84.5% None (many diffs) n/a
5 ccsbBroad304_03520 pLX_304 0% 82% 84.5% V5 (many diffs) n/a
6 TRCN0000466810 CTACTAACCATCCGTCAGTTTTTA pLX_317 57.6% 82% 84.5% V5 (many diffs) n/a
Download CSV