Transcript: Human NM_001136216.2

Homo sapiens transmembrane protein 51 (TMEM51), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-01
Taxon:
Homo sapiens (human)
Gene:
TMEM51 (55092)
Length:
1982
CDS:
486..1247

Additional Resources:

NCBI RefSeq record:
NM_001136216.2
NBCI Gene record:
TMEM51 (55092)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001136216.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000128296 GCTGAAAGTTCGAAGGATTAA pLKO.1 1085 CDS 100% 13.200 18.480 N TMEM51 n/a
2 TRCN0000318915 GCTGAAAGTTCGAAGGATTAA pLKO_005 1085 CDS 100% 13.200 18.480 N TMEM51 n/a
3 TRCN0000129674 CTGGTTTAGATTGTGGTTGTT pLKO.1 1583 3UTR 100% 4.950 6.930 N TMEM51 n/a
4 TRCN0000128798 CTCTGTATCAGGAGTGACTTT pLKO.1 1392 3UTR 100% 4.950 3.960 N TMEM51 n/a
5 TRCN0000148959 GCTTTCTATCTGCCTGAGTAT pLKO.1 719 CDS 100% 4.950 3.960 N TMEM51 n/a
6 TRCN0000275279 AGGCTGCCTCAAGGTACTATG pLKO_005 856 CDS 100% 10.800 7.560 N TMEM51 n/a
7 TRCN0000275280 AGTTGGCCAAACGACTGAAAC pLKO_005 1063 CDS 100% 10.800 7.560 N TMEM51 n/a
8 TRCN0000285337 GTGAATCTGTGGACCACATTC pLKO_005 1472 3UTR 100% 10.800 7.560 N TMEM51 n/a
9 TRCN0000150064 CCTCAAAGACTTTAGGATCAA pLKO.1 1121 CDS 100% 4.950 3.465 N TMEM51 n/a
10 TRCN0000285335 CCTCAAAGACTTTAGGATCAA pLKO_005 1121 CDS 100% 4.950 3.465 N TMEM51 n/a
11 TRCN0000149386 GCTGGTTTAGATTGTGGTTGT pLKO.1 1582 3UTR 100% 4.050 2.835 N TMEM51 n/a
12 TRCN0000075587 GAGGAAGAAGAGGAGGATGAA pLKO.1 834 CDS 100% 4.950 2.475 Y Hmgb2 n/a
13 TRCN0000173568 GAGGAAGAAGAGGAGGATGAA pLKO.1 834 CDS 100% 4.950 2.475 Y Chic1 n/a
14 TRCN0000301335 GAGGAAGAAGAGGAGGATGAA pLKO_005 834 CDS 100% 4.950 2.475 Y Hmgb2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001136216.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03520 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03520 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000466810 CTACTAACCATCCGTCAGTTTTTA pLX_317 57.6% 100% 100% V5 n/a
4 ccsbBroadEn_08468 pDONR223 100% 99.8% 100% None 600G>A n/a
5 ccsbBroad304_08468 pLX_304 0% 99.8% 100% V5 600G>A n/a
6 TRCN0000472953 GATTAACTCCATCATTCTTGGTTC pLX_317 47.6% 99.8% 100% V5 600G>A n/a
7 ccsbBroadEn_12155 pDONR223 100% 53.2% 45% None 342_345delCAGC;397A>T;410_759del n/a
8 ccsbBroad304_12155 pLX_304 0% 53.2% 45% V5 342_345delCAGC;397A>T;410_759del n/a
9 TRCN0000469095 CCACTGTATCTTGTTACTTGGTCA pLX_317 100% 53.2% 45% V5 342_345delCAGC;397A>T;410_759del n/a
Download CSV